ID: 1117256350

View in Genome Browser
Species Human (GRCh38)
Location 14:53981766-53981788
Sequence CAATATTGAATCAATGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117256350_1117256352 5 Left 1117256350 14:53981766-53981788 CCAGTCTCATTGATTCAATATTG No data
Right 1117256352 14:53981794-53981816 ATGTAGGTAGTAGACCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117256350 Original CRISPR CAATATTGAATCAATGAGAC TGG (reversed) Intergenic
No off target data available for this crispr