ID: 1117268928

View in Genome Browser
Species Human (GRCh38)
Location 14:54121272-54121294
Sequence CAGAATGCCTGTCTGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117268928_1117268935 29 Left 1117268928 14:54121272-54121294 CCAGGTTCCAGACAGGCATTCTG No data
Right 1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG No data
1117268928_1117268930 -10 Left 1117268928 14:54121272-54121294 CCAGGTTCCAGACAGGCATTCTG No data
Right 1117268930 14:54121285-54121307 AGGCATTCTGCCCACATCTGTGG No data
1117268928_1117268931 -9 Left 1117268928 14:54121272-54121294 CCAGGTTCCAGACAGGCATTCTG No data
Right 1117268931 14:54121286-54121308 GGCATTCTGCCCACATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117268928 Original CRISPR CAGAATGCCTGTCTGGAACC TGG (reversed) Intergenic
No off target data available for this crispr