ID: 1117268932

View in Genome Browser
Species Human (GRCh38)
Location 14:54121295-54121317
Sequence GGTACATATCCCACAGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117268932_1117268937 10 Left 1117268932 14:54121295-54121317 CCCACATCTGTGGGATATGTACC No data
Right 1117268937 14:54121328-54121350 CCAAAGATGAGTTTTGTGGTTGG No data
1117268932_1117268935 6 Left 1117268932 14:54121295-54121317 CCCACATCTGTGGGATATGTACC No data
Right 1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117268932 Original CRISPR GGTACATATCCCACAGATGT GGG (reversed) Intergenic
No off target data available for this crispr