ID: 1117268935

View in Genome Browser
Species Human (GRCh38)
Location 14:54121324-54121346
Sequence CACTCCAAAGATGAGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117268929_1117268935 22 Left 1117268929 14:54121279-54121301 CCAGACAGGCATTCTGCCCACAT No data
Right 1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG No data
1117268928_1117268935 29 Left 1117268928 14:54121272-54121294 CCAGGTTCCAGACAGGCATTCTG No data
Right 1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG No data
1117268933_1117268935 5 Left 1117268933 14:54121296-54121318 CCACATCTGTGGGATATGTACCA No data
Right 1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG No data
1117268932_1117268935 6 Left 1117268932 14:54121295-54121317 CCCACATCTGTGGGATATGTACC No data
Right 1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117268935 Original CRISPR CACTCCAAAGATGAGTTTTG TGG Intergenic
No off target data available for this crispr