ID: 1117269013

View in Genome Browser
Species Human (GRCh38)
Location 14:54122172-54122194
Sequence CTCACTGCCTTGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117269008_1117269013 6 Left 1117269008 14:54122143-54122165 CCCAAAACCATTCTTGATCCAAG No data
Right 1117269013 14:54122172-54122194 CTCACTGCCTTGAATGAAGATGG No data
1117269010_1117269013 -1 Left 1117269010 14:54122150-54122172 CCATTCTTGATCCAAGTTCTGCC No data
Right 1117269013 14:54122172-54122194 CTCACTGCCTTGAATGAAGATGG No data
1117269009_1117269013 5 Left 1117269009 14:54122144-54122166 CCAAAACCATTCTTGATCCAAGT No data
Right 1117269013 14:54122172-54122194 CTCACTGCCTTGAATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117269013 Original CRISPR CTCACTGCCTTGAATGAAGA TGG Intergenic
No off target data available for this crispr