ID: 1117271966

View in Genome Browser
Species Human (GRCh38)
Location 14:54153878-54153900
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117271966_1117271970 28 Left 1117271966 14:54153878-54153900 CCAATTAAATGTACCATGTGACT No data
Right 1117271970 14:54153929-54153951 AGAAGCAAGACACAGAAAACTGG No data
1117271966_1117271969 -4 Left 1117271966 14:54153878-54153900 CCAATTAAATGTACCATGTGACT No data
Right 1117271969 14:54153897-54153919 GACTTGGTAGAATTTCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117271966 Original CRISPR AGTCACATGGTACATTTAAT TGG (reversed) Intergenic
No off target data available for this crispr