ID: 1117272555

View in Genome Browser
Species Human (GRCh38)
Location 14:54159697-54159719
Sequence CCTTCTCCAGGACCTTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117272555_1117272561 12 Left 1117272555 14:54159697-54159719 CCCCTTCAAGGTCCTGGAGAAGG No data
Right 1117272561 14:54159732-54159754 AAAAGAAATTATGACAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117272555 Original CRISPR CCTTCTCCAGGACCTTGAAG GGG (reversed) Intergenic
No off target data available for this crispr