ID: 1117272856

View in Genome Browser
Species Human (GRCh38)
Location 14:54162944-54162966
Sequence TAGAATAAACATGAGGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117272854_1117272856 10 Left 1117272854 14:54162911-54162933 CCATTATAAGCTTAGCTTCAGGT No data
Right 1117272856 14:54162944-54162966 TAGAATAAACATGAGGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117272856 Original CRISPR TAGAATAAACATGAGGACTA AGG Intergenic
No off target data available for this crispr