ID: 1117277744

View in Genome Browser
Species Human (GRCh38)
Location 14:54206692-54206714
Sequence CAGTCCAACCCAAGATCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117277735_1117277744 17 Left 1117277735 14:54206652-54206674 CCACATTCAAGAGAGCATGTGGG No data
Right 1117277744 14:54206692-54206714 CAGTCCAACCCAAGATCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117277744 Original CRISPR CAGTCCAACCCAAGATCAAG GGG Intergenic
No off target data available for this crispr