ID: 1117281555

View in Genome Browser
Species Human (GRCh38)
Location 14:54246299-54246321
Sequence GTAGTATGCAGGAGTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117281555_1117281557 11 Left 1117281555 14:54246299-54246321 CCAGAGGAACTCCTGCATACTAC No data
Right 1117281557 14:54246333-54246355 ATACATCCCATCCTGCAGACAGG No data
1117281555_1117281558 12 Left 1117281555 14:54246299-54246321 CCAGAGGAACTCCTGCATACTAC No data
Right 1117281558 14:54246334-54246356 TACATCCCATCCTGCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117281555 Original CRISPR GTAGTATGCAGGAGTTCCTC TGG (reversed) Intergenic
No off target data available for this crispr