ID: 1117281558

View in Genome Browser
Species Human (GRCh38)
Location 14:54246334-54246356
Sequence TACATCCCATCCTGCAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117281556_1117281558 1 Left 1117281556 14:54246310-54246332 CCTGCATACTACATAGAAAAAGC No data
Right 1117281558 14:54246334-54246356 TACATCCCATCCTGCAGACAGGG No data
1117281555_1117281558 12 Left 1117281555 14:54246299-54246321 CCAGAGGAACTCCTGCATACTAC No data
Right 1117281558 14:54246334-54246356 TACATCCCATCCTGCAGACAGGG No data
1117281554_1117281558 24 Left 1117281554 14:54246287-54246309 CCACAATGAAAACCAGAGGAACT No data
Right 1117281558 14:54246334-54246356 TACATCCCATCCTGCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117281558 Original CRISPR TACATCCCATCCTGCAGACA GGG Intergenic
No off target data available for this crispr