ID: 1117288262

View in Genome Browser
Species Human (GRCh38)
Location 14:54308135-54308157
Sequence TAAGATAGTTCAGCATGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117288260_1117288262 12 Left 1117288260 14:54308100-54308122 CCTACCTTTATTTACTACTTGGC No data
Right 1117288262 14:54308135-54308157 TAAGATAGTTCAGCATGTGCAGG No data
1117288257_1117288262 24 Left 1117288257 14:54308088-54308110 CCCTTCTGCAAACCTACCTTTAT No data
Right 1117288262 14:54308135-54308157 TAAGATAGTTCAGCATGTGCAGG No data
1117288258_1117288262 23 Left 1117288258 14:54308089-54308111 CCTTCTGCAAACCTACCTTTATT No data
Right 1117288262 14:54308135-54308157 TAAGATAGTTCAGCATGTGCAGG No data
1117288261_1117288262 8 Left 1117288261 14:54308104-54308126 CCTTTATTTACTACTTGGCTATA No data
Right 1117288262 14:54308135-54308157 TAAGATAGTTCAGCATGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117288262 Original CRISPR TAAGATAGTTCAGCATGTGC AGG Intergenic
No off target data available for this crispr