ID: 1117291289

View in Genome Browser
Species Human (GRCh38)
Location 14:54336192-54336214
Sequence TTGCAAAATGCTACCACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117291286_1117291289 6 Left 1117291286 14:54336163-54336185 CCCTGGTTATGATATTATACTAT 0: 2
1: 1
2: 6
3: 43
4: 288
Right 1117291289 14:54336192-54336214 TTGCAAAATGCTACCACTGAGGG No data
1117291287_1117291289 5 Left 1117291287 14:54336164-54336186 CCTGGTTATGATATTATACTATA 0: 3
1: 11
2: 123
3: 349
4: 773
Right 1117291289 14:54336192-54336214 TTGCAAAATGCTACCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117291289 Original CRISPR TTGCAAAATGCTACCACTGA GGG Intergenic
No off target data available for this crispr