ID: 1117293329

View in Genome Browser
Species Human (GRCh38)
Location 14:54354479-54354501
Sequence CAGGCTGTTTCTCTGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117293324_1117293329 14 Left 1117293324 14:54354442-54354464 CCCCAGGCTGCTGTTTGTGCCTA No data
Right 1117293329 14:54354479-54354501 CAGGCTGTTTCTCTGTTTGAAGG No data
1117293326_1117293329 12 Left 1117293326 14:54354444-54354466 CCAGGCTGCTGTTTGTGCCTATA No data
Right 1117293329 14:54354479-54354501 CAGGCTGTTTCTCTGTTTGAAGG No data
1117293328_1117293329 -5 Left 1117293328 14:54354461-54354483 CCTATAGCTTTGATTTTTCAGGC No data
Right 1117293329 14:54354479-54354501 CAGGCTGTTTCTCTGTTTGAAGG No data
1117293325_1117293329 13 Left 1117293325 14:54354443-54354465 CCCAGGCTGCTGTTTGTGCCTAT No data
Right 1117293329 14:54354479-54354501 CAGGCTGTTTCTCTGTTTGAAGG No data
1117293323_1117293329 24 Left 1117293323 14:54354432-54354454 CCTGAGTTTTCCCCAGGCTGCTG No data
Right 1117293329 14:54354479-54354501 CAGGCTGTTTCTCTGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117293329 Original CRISPR CAGGCTGTTTCTCTGTTTGA AGG Intergenic
No off target data available for this crispr