ID: 1117295980

View in Genome Browser
Species Human (GRCh38)
Location 14:54379290-54379312
Sequence CCACCCAGTGATATTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117295980_1117295985 22 Left 1117295980 14:54379290-54379312 CCACAGCCAATATCACTGGGTGG No data
Right 1117295985 14:54379335-54379357 TTGAAAATCAGCACAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117295980 Original CRISPR CCACCCAGTGATATTGGCTG TGG (reversed) Intergenic
No off target data available for this crispr