ID: 1117296605

View in Genome Browser
Species Human (GRCh38)
Location 14:54386164-54386186
Sequence ACGGATGTTAAGACCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117296605_1117296608 -5 Left 1117296605 14:54386164-54386186 CCCCTCTGGGTCTTAACATCCGT No data
Right 1117296608 14:54386182-54386204 TCCGTTGACCTGTTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117296605 Original CRISPR ACGGATGTTAAGACCCAGAG GGG (reversed) Intergenic
No off target data available for this crispr