ID: 1117297791

View in Genome Browser
Species Human (GRCh38)
Location 14:54394824-54394846
Sequence CTCCCGAAGCGTGGCTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117297786_1117297791 3 Left 1117297786 14:54394798-54394820 CCACAGTGCAGCGGCGGGCCGAA 0: 31
1: 258
2: 814
3: 807
4: 403
Right 1117297791 14:54394824-54394846 CTCCCGAAGCGTGGCTAGAGTGG No data
1117297781_1117297791 22 Left 1117297781 14:54394779-54394801 CCAGCACACAGAGGGGCTCCCAC No data
Right 1117297791 14:54394824-54394846 CTCCCGAAGCGTGGCTAGAGTGG No data
1117297785_1117297791 4 Left 1117297785 14:54394797-54394819 CCCACAGTGCAGCGGCGGGCCGA 0: 30
1: 256
2: 809
3: 810
4: 397
Right 1117297791 14:54394824-54394846 CTCCCGAAGCGTGGCTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117297791 Original CRISPR CTCCCGAAGCGTGGCTAGAG TGG Intergenic
No off target data available for this crispr