ID: 1117299168

View in Genome Browser
Species Human (GRCh38)
Location 14:54407221-54407243
Sequence CGTCCCAGAGGGGCACCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 3, 1: 4, 2: 7, 3: 20, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117299164_1117299168 -10 Left 1117299164 14:54407208-54407230 CCTCTGGAAGTTTCGTCCCAGAG 0: 18
1: 496
2: 3556
3: 2308
4: 1120
Right 1117299168 14:54407221-54407243 CGTCCCAGAGGGGCACCTGCCGG 0: 3
1: 4
2: 7
3: 20
4: 172
1117299162_1117299168 0 Left 1117299162 14:54407198-54407220 CCTGCTCCTTCCTCTGGAAGTTT 0: 20
1: 366
2: 2766
3: 2310
4: 1421
Right 1117299168 14:54407221-54407243 CGTCCCAGAGGGGCACCTGCCGG 0: 3
1: 4
2: 7
3: 20
4: 172
1117299163_1117299168 -6 Left 1117299163 14:54407204-54407226 CCTTCCTCTGGAAGTTTCGTCCC 0: 17
1: 402
2: 1450
3: 1314
4: 787
Right 1117299168 14:54407221-54407243 CGTCCCAGAGGGGCACCTGCCGG 0: 3
1: 4
2: 7
3: 20
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117299168 Original CRISPR CGTCCCAGAGGGGCACCTGC CGG Intronic
900151260 1:1180242-1180264 CCTCCTGGAGGGGCTCCTGCTGG + Exonic
900370873 1:2331557-2331579 CGTGCCTGAGGGGGACCTGGTGG + Intronic
900408078 1:2501171-2501193 CTGCCCAGAGGCGCCCCTGCAGG + Intronic
900509755 1:3052976-3052998 CCTCACACAGGGGCATCTGCTGG + Intergenic
901186830 1:7379003-7379025 CGCCTCAGGGTGGCACCTGCAGG + Intronic
905882531 1:41474131-41474153 CATCCCTCAGGGGGACCTGCAGG + Intergenic
906511225 1:46411419-46411441 GGCCCCAGAGGGGCACAGGCTGG - Intronic
911982833 1:104587139-104587161 CATCCCAGAGGAGCACCCACTGG - Intergenic
912452280 1:109774383-109774405 CTTCCCCGAGTGGCACCGGCTGG - Intronic
912845760 1:113073427-113073449 CGTCCCGGAGGAGCAGTTGCTGG + Exonic
913108578 1:115638848-115638870 TGTCCCAGAGGGGCACCTGCCGG + Intergenic
915120939 1:153629215-153629237 CATGCCAGAGGGGCAGCTGGAGG - Intronic
916800001 1:168207803-168207825 CTTCCCAGACGGGCGGCTGCCGG + Intergenic
917969171 1:180196341-180196363 CGTCCCACACGGGCACATCCAGG - Exonic
921484777 1:215703189-215703211 TGTCCCAGAGGGGCACCTGCCGG + Intronic
921976418 1:221207661-221207683 CATCCCAGAGGGGCACCCACTGG - Intergenic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1063109302 10:3020729-3020751 GTTCCCAGAGGAGCAGCTGCAGG - Intergenic
1063531779 10:6840151-6840173 TGTCCCAAAGCCGCACCTGCTGG + Intergenic
1067064707 10:43097230-43097252 GGCCCCAGAGGAGCACCTGTGGG + Intronic
1068413256 10:56684580-56684602 CGTCTCAGAGGGGTACCTGCTGG - Intergenic
1068951654 10:62783070-62783092 CGTCCCAGAGGGGCACCTGCCGG - Intergenic
1070966235 10:80532962-80532984 CCCCCCAGAGAGGGACCTGCAGG - Exonic
1071311461 10:84347652-84347674 CTTCCCAGACGGGCGGCTGCCGG + Intronic
1073051198 10:100668411-100668433 CGTCCCAGGGGGGCAGTTGGAGG - Intergenic
1074430081 10:113386928-113386950 AGGCCCAGAGGGGCACATGCTGG - Intergenic
1075598997 10:123753405-123753427 GGACCCTGAGGGGCACCTGCAGG + Intronic
1075664335 10:124219925-124219947 CGTCCCAGAGGGGGACAGGGAGG - Intergenic
1076304476 10:129454857-129454879 GATGCCAGAGGGGCACCTGCAGG - Intergenic
1076734707 10:132453369-132453391 CGTTCCGGAGTGGCCCCTGCAGG + Intergenic
1078182945 11:9027703-9027725 CTTCCCAGAGGGCCCCCTGTGGG + Intronic
1079909256 11:26288844-26288866 CTTCCCAGAGGGACATTTGCAGG - Intergenic
1083618648 11:64038287-64038309 GGTCCCAGAGGGGAGGCTGCAGG - Intronic
1085609460 11:77933751-77933773 CTTCCCAGACGGGCGGCTGCTGG - Intronic
1088694579 11:112355858-112355880 CTGCCCAGAGGGCCCCCTGCTGG - Intergenic
1089030691 11:115325287-115325309 CGTCCCAGACGTGCATCTCCTGG + Intronic
1089680783 11:120117783-120117805 TTTCCCAAAGGGGCGCCTGCAGG + Intronic
1090381120 11:126328418-126328440 CTTTCCTGAGGTGCACCTGCAGG - Intronic
1090450160 11:126798929-126798951 CGCCACAGAGGAGCACATGCAGG + Intronic
1091263777 11:134254054-134254076 CGGGCCGGAGGGGAACCTGCGGG - Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1091367863 11:135037327-135037349 CGTCACAGAGGGAGGCCTGCAGG - Intergenic
1092077660 12:5686652-5686674 CTTCCCAGAGGGGCCCATGGAGG - Intronic
1092703338 12:11257095-11257117 TGTCCCAGAGGGGCACCCAGCGG - Intergenic
1097054947 12:56243619-56243641 AGTCTCAGAGGGGAGCCTGCAGG - Intronic
1102815311 12:115860604-115860626 TTTCCCAAAGGGGCACCTGGTGG + Intergenic
1103719873 12:122967441-122967463 CGGCCCAGAGGGGCAGCAGGTGG + Intronic
1104467103 12:128999553-128999575 AGCCCCAGTGGGGCCCCTGCAGG + Intergenic
1105599686 13:21875688-21875710 AGCCTCAGAGGGGCTCCTGCAGG - Intergenic
1107562700 13:41572108-41572130 CTTCGCAGACGGGCAGCTGCCGG - Intronic
1112153853 13:96795856-96795878 CTTCCTAGAGGGGCTGCTGCTGG + Intronic
1113500855 13:110772909-110772931 CTTCCCAAATGGGCCCCTGCAGG + Intergenic
1113533592 13:111046706-111046728 CGTGCAACAGGGGCACCTCCTGG + Intergenic
1113917519 13:113883428-113883450 CGTCCCTCAGCGGCCCCTGCGGG + Intergenic
1114507928 14:23232523-23232545 CCTCCCAGAGGGGTGGCTGCTGG - Intronic
1117104355 14:52382915-52382937 CATCCCAGAGGGGCACCCACTGG - Intergenic
1117299168 14:54407221-54407243 CGTCCCAGAGGGGCACCTGCCGG + Intronic
1119669468 14:76507596-76507618 GGTCCCAGAGGGGCACATCCTGG - Intergenic
1119747274 14:77053258-77053280 CGTCCCAGAGGGCTGCCTGCTGG + Intergenic
1119815516 14:77563359-77563381 GGTCCCACAGGGCCAACTGCAGG - Intronic
1122799519 14:104222706-104222728 CATCACACAGGGGCACCTGAGGG + Intergenic
1127023811 15:54781332-54781354 CCTCCCAGACGGGCAGCTGCCGG + Intergenic
1127859064 15:62978086-62978108 CTCCACAGAGGGGCACCTGAGGG + Intergenic
1129110160 15:73332492-73332514 GGTCCCAGAGGGACATCTCCTGG + Intronic
1129653868 15:77510083-77510105 CCCCCCACAGGGGCATCTGCGGG + Intergenic
1132315983 15:100890958-100890980 AGTCCCTGAGTGGCAGCTGCTGG + Intronic
1132553799 16:564160-564182 AGTCCCAGAGGGGCTCCTGGGGG - Exonic
1133143907 16:3769464-3769486 TTTCACAGAAGGGCACCTGCTGG - Intronic
1134243362 16:12522051-12522073 TGGCCCCGAGGGGCCCCTGCTGG + Intronic
1135178826 16:20255425-20255447 CTTCCCAGGGGGGCACATTCAGG - Intergenic
1136159068 16:28406092-28406114 GGTTCCACAGGGGCAACTGCGGG + Intergenic
1136204019 16:28709191-28709213 GGTTCCACAGGGGCAACTGCGGG - Intronic
1141284925 16:82662774-82662796 CCTCCCAGAGGGACACATACTGG - Intronic
1141766877 16:86064617-86064639 AGTCCCAGAGGGAAACCTGAAGG - Intergenic
1141887432 16:86902100-86902122 CGTCCAGGAGAGGCACCTGAGGG + Intergenic
1141949155 16:87329673-87329695 AGACCCCGAGGCGCACCTGCTGG - Exonic
1142067913 16:88073279-88073301 CTTCACAGCGGGGCAGCTGCGGG + Intronic
1142155325 16:88530290-88530312 AGTCCCTGAGGGGCAGCTGCGGG + Intronic
1142342167 16:89530862-89530884 TCTCCCAGAAGGGCTCCTGCGGG + Intronic
1142639988 17:1280193-1280215 CATCTCCGAGGGGCACCTGGAGG + Exonic
1143374885 17:6461628-6461650 CGTCTCAGGAGGGCAGCTGCGGG - Intronic
1143951913 17:10639381-10639403 CCTCCAAGAGGCGCACCAGCAGG - Exonic
1145029629 17:19494992-19495014 CGTCCAAGAGGCCCACCCGCAGG - Intergenic
1146062070 17:29612880-29612902 CCTCCCAGATGGTGACCTGCGGG - Exonic
1147336120 17:39727760-39727782 CTTTCCAGAGTGGCACCAGCAGG - Exonic
1147358192 17:39913818-39913840 CCTCCCAGATGGGAACCTACAGG + Intronic
1147458270 17:40552217-40552239 TGTCCCCGAGGGGAACCTGCCGG - Intergenic
1147590751 17:41681944-41681966 CTGCCCAGAGAGGCACCTCCAGG + Intergenic
1147723717 17:42553952-42553974 CGCCCCAGAGCGGCTCCCGCAGG - Intronic
1147811245 17:43171272-43171294 CGCCCCCGGGGGGCGCCTGCCGG - Intronic
1147994835 17:44354827-44354849 CGGCCTAGAGGAGCACCGGCGGG - Exonic
1151835785 17:76581752-76581774 CCTCCCAGAAGGGCATGTGCAGG - Intronic
1152031447 17:77845916-77845938 CCACCCAGGGGGCCACCTGCGGG - Intergenic
1152224327 17:79085741-79085763 CTTCCCAGAGGGGCTCGGGCTGG + Intronic
1153841785 18:9014542-9014564 GATCTCAGAGGTGCACCTGCTGG - Intergenic
1153941432 18:9981999-9982021 TGTCCCAGAGGGGCACCTGTTGG + Intergenic
1158853459 18:61518381-61518403 CTTCACAGAGGGGCACCTGCTGG - Intronic
1159704912 18:71674823-71674845 TGGACCAAAGGGGCACCTGCAGG + Intergenic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1161172467 19:2819920-2819942 AGTTCCTGAGGGGCGCCTGCGGG + Exonic
1161323799 19:3653340-3653362 CATGCCCGAGGGGCTCCTGCTGG - Exonic
1162477236 19:10907975-10907997 CCTCCCAGATGGCCACATGCTGG + Intronic
1163500229 19:17671887-17671909 TGTCCCAGATGGGCAGCAGCAGG - Intronic
1165422353 19:35728492-35728514 GGGCCCGGAGGGGTACCTGCTGG + Intronic
1168613486 19:57819561-57819583 CTACCCAGAGGTGCATCTGCAGG - Intronic
926237288 2:11055209-11055231 CCTCCCAGAGGGGCACACGTGGG + Intergenic
926252772 2:11165255-11165277 CTTCTCAGAGGGGCGGCTGCCGG + Intronic
927509246 2:23634228-23634250 TCTCCCAGATGGGAACCTGCAGG - Intronic
927955449 2:27204544-27204566 CCACGCAGAGGGACACCTGCTGG + Exonic
929174075 2:38959756-38959778 CGGCCCCGAGGGGCGCCGGCAGG + Intronic
930090476 2:47528005-47528027 TGTCCCAGAGGTGAGCCTGCTGG - Intronic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
931773890 2:65523346-65523368 GGTCTCAGATGGGCACCTGAGGG + Intergenic
933975272 2:87504505-87504527 GGTCCAAGAGGGGCTGCTGCAGG + Intergenic
936318554 2:111446308-111446330 GGTCCAAGAGGGGCTGCTGCAGG - Intergenic
937097898 2:119247672-119247694 CACCGCAGATGGGCACCTGCGGG - Exonic
940054455 2:149499591-149499613 CATCCCAGAGGGGCACCCACCGG + Intergenic
945533682 2:210986594-210986616 CGTCCCAGAGGGGCACCTGCCGG + Intergenic
946167443 2:217873591-217873613 TGTCCATGAGGGCCACCTGCAGG + Intronic
947461319 2:230306789-230306811 TTGCCCAAAGGGGCACCTGCAGG - Intronic
948676780 2:239601504-239601526 CCTCACAAAAGGGCACCTGCAGG - Intergenic
948794719 2:240396445-240396467 CCACCAAGAGGGGCCCCTGCAGG + Intergenic
1168880669 20:1203764-1203786 GGTCCCAGAGGGGAGACTGCAGG - Intronic
1172129185 20:32644563-32644585 AGTCCCCTGGGGGCACCTGCAGG + Intergenic
1173248781 20:41353710-41353732 GCTCCCAGAGGGGCAGGTGCAGG - Intronic
1173339662 20:42141895-42141917 GCTCCCAGAAGGGCACCTACAGG + Exonic
1173864913 20:46307614-46307636 CGGCCCACAGGGACCCCTGCCGG - Intronic
1175121324 20:56718284-56718306 AGTCCCAGATGGGCACCTCCAGG - Intergenic
1176043919 20:63082731-63082753 CTTCCCAGAGGGCCCCCAGCAGG + Intergenic
1177388183 21:20433695-20433717 TGTCCCAGAGGGGCACTGACCGG - Intergenic
1177763849 21:25434218-25434240 CCTCCCAGAGGGGCACCCACTGG - Intergenic
1178519850 21:33280136-33280158 CCTCCCTGAAGGGCAGCTGCAGG + Intronic
1178903346 21:36615396-36615418 GAACTCAGAGGGGCACCTGCAGG - Intergenic
1180844224 22:18972691-18972713 CCTGGCAGAGGGGCACGTGCAGG + Intergenic
1181057248 22:20266020-20266042 CCTGGCAGAGGGGCACGTGCAGG - Intronic
1181645818 22:24231453-24231475 AGTCCCCCAGGGGCACCTCCAGG + Exonic
1185146529 22:49140036-49140058 CCTCCCATATGGGCACCTCCTGG + Intergenic
1185271135 22:49929699-49929721 GGTCCCACAGCGCCACCTGCTGG - Intergenic
949924367 3:9029329-9029351 TGTCCCAGAGGTGAACCTCCTGG + Intronic
950377487 3:12583813-12583835 CGCCCCATAGGGGCAGCTCCTGG + Exonic
950479458 3:13235543-13235565 AGTCTCAGAGGGGCACCTCTGGG - Intergenic
950742768 3:15063420-15063442 GGTCCCAGTGGGGCAGCTGAAGG + Intronic
958196311 3:90245885-90245907 GTTTCCAGAGGGGCACCTGAAGG - Intergenic
958419503 3:93914527-93914549 GTTTCCAGAGGGGCACCTGCAGG - Intronic
960994419 3:123331612-123331634 GGTGCCACAGGGCCACCTGCAGG + Intronic
961987599 3:131154200-131154222 CTTTCCAGAGGACCACCTGCAGG - Intronic
965774034 3:172209805-172209827 CCGGCCCGAGGGGCACCTGCAGG + Intronic
966852088 3:184170636-184170658 CGGCCCGGAGGGGCTCCTGGGGG - Exonic
966905806 3:184525397-184525419 AGTCCCCGAGGATCACCTGCGGG - Intronic
968613058 4:1565747-1565769 TGTCCCCATGGGGCACCTGCGGG - Intergenic
970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG + Intergenic
975485708 4:74932941-74932963 CGGCCCAGAGCGGCCTCTGCTGG - Intergenic
977500344 4:97829136-97829158 CGTCCCAGAGGGGCACCCACCGG - Intronic
978313359 4:107410054-107410076 CGTCCGAGAGTGGCACCCACCGG - Intergenic
980494095 4:133569698-133569720 CATCCAAGAGGGCCACCTGATGG + Intergenic
981748508 4:148072615-148072637 CTTCCTAGACGGCCACCTGCAGG + Exonic
998638705 5:143985692-143985714 CTCCCCAGAGGGGCAGCTCCAGG + Intergenic
1000860342 5:166449905-166449927 TGTCCCAGAGGGGTAGCTACTGG + Intergenic
1001754670 5:174159318-174159340 GGTCCCAGAGCGGCAGCTGGTGG + Intronic
1006118974 6:31792547-31792569 CGTCCAAGAGGGTCCCCAGCTGG - Intronic
1007211715 6:40197668-40197690 CGTCTCAGAAGGGCCCCAGCAGG - Intergenic
1008649661 6:53549392-53549414 CATCTCAGAGGGCTACCTGCTGG + Intronic
1010615423 6:78006241-78006263 TGTCCTAGAGGGGCACCTGCCGG - Intergenic
1013964295 6:115936105-115936127 CGTCCCAGAGGGGCACCCACTGG - Exonic
1014569124 6:122986954-122986976 CGTCCCAGAGAGGCACCCGCCGG - Intergenic
1018469538 6:164083399-164083421 TGTCCAAGAGGACCACCTGCCGG + Intergenic
1018836513 6:167488256-167488278 CCTCCCAGAGCCGCACCTGCCGG - Intergenic
1018914359 6:168123758-168123780 CCTTCAAGAGGGTCACCTGCTGG + Intergenic
1019032467 6:169024682-169024704 CGGCCCCGAGAGCCACCTGCGGG - Intergenic
1019355513 7:576806-576828 CTTCCCTGAGGGGCACATTCAGG - Intronic
1021769031 7:23980166-23980188 CATCCCAGTGTTGCACCTGCTGG - Intergenic
1023129315 7:36986829-36986851 CCTCCCAGTGGGACCCCTGCTGG - Intronic
1023996846 7:45163793-45163815 CGTGCCAGTGGGGCATCTGGAGG + Intronic
1024153044 7:46591727-46591749 CAACCCAGAGAGGCACTTGCCGG - Intergenic
1024582293 7:50809855-50809877 CCTCCAGGAGGGACACCTGCAGG + Intergenic
1024944263 7:54792854-54792876 CTTCCCAGACGGGCAGCAGCTGG + Intergenic
1033133942 7:138769035-138769057 GGTCCCAGAGGCCCACCTGGAGG - Intronic
1035052038 7:156004578-156004600 CGTCCCAGAAGGGTGCCTTCTGG + Intergenic
1035272377 7:157728051-157728073 AGGCCCAGAGGGGCTCCTGAGGG + Intronic
1035341473 7:158165302-158165324 CGTCCCAGAGGGAGAGGTGCTGG + Intronic
1035654473 8:1295352-1295374 AGTCCCAGCGTGGCAGCTGCAGG + Intergenic
1039272465 8:35897885-35897907 CATCTCAGAGGAGCTCCTGCAGG + Intergenic
1044409505 8:91868054-91868076 CATCTCAAAGGGGGACCTGCAGG - Intergenic
1045998993 8:108397018-108397040 TCTCCCAGAGGGTCACCAGCAGG + Intronic
1049178283 8:141207023-141207045 CTTCCCAGAGGGCCGCCAGCTGG - Intergenic
1049357775 8:142197126-142197148 CTTCCCAGAGGGTCAGGTGCTGG - Intergenic
1049758321 8:144320612-144320634 GGGCTCAAAGGGGCACCTGCAGG - Intronic
1049808799 8:144553959-144553981 CGGCCCAGAGGTGCAGCTGCTGG + Intronic
1051079465 9:13278876-13278898 CGTCCGGGAGCGGCCCCTGCAGG + Intronic
1056934861 9:90908773-90908795 CGCCCCAGAGGGGCAGAGGCAGG - Intergenic
1057792276 9:98132187-98132209 GGTCCCACAAGGCCACCTGCCGG + Exonic
1060530931 9:124346665-124346687 CAGCCCAGCGTGGCACCTGCTGG - Intronic
1061042811 9:128149669-128149691 GGGCCAAGAGGGGCACCTGCAGG + Intronic
1061680411 9:132240259-132240281 CGTCACAGGGGGCCAGCTGCAGG + Intronic
1061944586 9:133901639-133901661 CTGCCCTGAGGGGCTCCTGCCGG + Intronic
1062297694 9:135841613-135841635 TGTCCCAGAAGGGCACCCTCCGG - Intronic
1062531383 9:137002218-137002240 CGTGCTGGAGGGGCGCCTGCTGG + Intergenic
1062598725 9:137310747-137310769 GGTCCCAGGCAGGCACCTGCAGG + Intronic
1186773231 X:12838733-12838755 CATCCCAGAGGGGCACTCACTGG + Intergenic
1191772405 X:64775205-64775227 CTTCCCAGAGGGGCACCTGCTGG - Intergenic
1192533757 X:71911243-71911265 GGACCTCGAGGGGCACCTGCTGG + Intergenic
1193382077 X:80827548-80827570 CCTCCCAGAGGGGCACCCACCGG + Intergenic
1198660305 X:138961391-138961413 TGTCTCTGAGGGGCACCTACTGG + Intronic
1199721081 X:150543177-150543199 GGTCCCAGAGGGGCACTGGTTGG - Intergenic
1201406080 Y:13651932-13651954 TGTCCCACAGGAGCACCTGCCGG + Intergenic
1202047994 Y:20753340-20753362 CCTCCCAGAGGGGCAGCAGAAGG + Intergenic