ID: 1117301010

View in Genome Browser
Species Human (GRCh38)
Location 14:54428077-54428099
Sequence CACAGCTGAAAGCTTAATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117301002_1117301010 12 Left 1117301002 14:54428042-54428064 CCCCTATTCCCTTCCAATTTTAG 0: 1
1: 0
2: 1
3: 23
4: 498
Right 1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1117301003_1117301010 11 Left 1117301003 14:54428043-54428065 CCCTATTCCCTTCCAATTTTAGC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1117301008_1117301010 -1 Left 1117301008 14:54428055-54428077 CCAATTTTAGCAAGTAGAACGGC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1117301006_1117301010 3 Left 1117301006 14:54428051-54428073 CCTTCCAATTTTAGCAAGTAGAA 0: 1
1: 0
2: 4
3: 14
4: 234
Right 1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1117301005_1117301010 4 Left 1117301005 14:54428050-54428072 CCCTTCCAATTTTAGCAAGTAGA 0: 1
1: 0
2: 0
3: 16
4: 201
Right 1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1117301004_1117301010 10 Left 1117301004 14:54428044-54428066 CCTATTCCCTTCCAATTTTAGCA 0: 1
1: 0
2: 5
3: 25
4: 241
Right 1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117301010 Original CRISPR CACAGCTGAAAGCTTAATGG CGG Intronic
900903644 1:5535193-5535215 CAAAGCTGAAAGCTTAGGTGAGG + Intergenic
901775692 1:11559139-11559161 CAAAGGAGAAAGCTGAATGGTGG - Intergenic
902919866 1:19659207-19659229 CACACCTGGACACTTAATGGCGG + Intergenic
904799160 1:33081009-33081031 CAGAGCTGAATGCTTTATGTCGG + Intergenic
906805930 1:48778482-48778504 CATAGAGGAATGCTTAATGGAGG + Intronic
908060778 1:60346217-60346239 AACAGCTAAAAACTTAAAGGTGG + Intergenic
914802177 1:150969820-150969842 CTCAGCTGAAAGCTTCCAGGGGG + Intronic
917110188 1:171539574-171539596 CAAAGCAGAAACCATAATGGTGG - Intronic
918131697 1:181635168-181635190 CAGAGGGGAAAGCTTAAGGGAGG - Intronic
918509151 1:185291241-185291263 CACAAATGAAATCTTAATGTGGG + Exonic
920205323 1:204286983-204287005 CACAGCTGAAAGCCACAAGGGGG + Intronic
924552793 1:245093883-245093905 AATAGCTGAAAACTTAATGCCGG - Intronic
924591556 1:245409169-245409191 CAAAACTGCAAGCTTCATGGTGG + Intronic
1068253786 10:54480328-54480350 CACACCTAAAAACTCAATGGAGG + Intronic
1071436441 10:85652138-85652160 CACAGCTGAAGGATGCATGGTGG - Intronic
1073143982 10:101267031-101267053 CACAGCTGAATACTTGAAGGTGG - Intergenic
1079140529 11:17806496-17806518 CTCAGCTGAAAACTAAGTGGTGG + Intronic
1079226244 11:18607922-18607944 CACAGCTGAAAGATTTCTGGTGG - Exonic
1080793936 11:35546095-35546117 CACAGCAGAAATGTCAATGGAGG - Intergenic
1080831278 11:35895517-35895539 CACACTTCACAGCTTAATGGGGG - Intergenic
1081581334 11:44354307-44354329 GAGAGCTGAAAGCCTAATTGAGG - Intergenic
1089282938 11:117387097-117387119 CACAGATGGAATCCTAATGGAGG - Intronic
1089736285 11:120552277-120552299 CAGAGCTGATTGCTTGATGGTGG + Intronic
1095413886 12:41954184-41954206 AACAGCAGAAAGCTTCTTGGTGG + Intergenic
1096525670 12:52208687-52208709 CACAACTGAATGCTAAATGATGG - Intergenic
1096635644 12:52957339-52957361 CAGAGCTGGAAGCTTAAAGCAGG + Intergenic
1098480572 12:70954291-70954313 AACAGCTGAAAGATTACTTGAGG - Intergenic
1100033229 12:90218826-90218848 CATAGCTGAAAGTTAAATGTGGG + Intergenic
1100571536 12:95847613-95847635 CACAGAAGACAGCTTAATGGGGG + Intergenic
1101330860 12:103756865-103756887 CACAGCAGAAAGATTAGTGTGGG - Intronic
1102446249 12:113005064-113005086 AACAGCTGAAAGCCTTTTGGAGG + Exonic
1105773234 13:23632679-23632701 CACAGCTGAAAACTTAAACCAGG + Intronic
1106365583 13:29076504-29076526 CACATCTGAAGGCTTGATGGAGG + Intronic
1107685079 13:42888982-42889004 CACTGCAGAAGGCTTGATGGAGG - Intronic
1109165822 13:59033520-59033542 CACAGATTAAAGCTAAATAGGGG + Intergenic
1109210385 13:59528337-59528359 CATAGCTGAATGCTTAAGGGTGG + Intergenic
1112328456 13:98459471-98459493 AACAGGTGAAGGCTTATTGGAGG + Intronic
1115415332 14:33126019-33126041 CACAGCTGAAGGCTAAATGGCGG - Intronic
1116234958 14:42268217-42268239 TACAGATGAAAGCCTAATGTAGG - Intergenic
1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG + Intronic
1118869999 14:69733573-69733595 CATAGTTGAAAGCTGGATGGAGG + Intronic
1119001116 14:70883106-70883128 CACAGCAGACAGTTTTATGGGGG - Intergenic
1119525896 14:75321993-75322015 CATAGCTGAAAGTTTAATAATGG - Intergenic
1126064516 15:44815923-44815945 CCCACCTGAAAGCTACATGGGGG + Intergenic
1129230057 15:74192118-74192140 GTCAGCTCAAAGCTTGATGGGGG + Intronic
1129444956 15:75610490-75610512 CACAGCTGACAGGATGATGGGGG + Intronic
1131948579 15:97654866-97654888 CCCTGCTGACAGCTTAATGAAGG + Intergenic
1132365565 15:101253980-101254002 CTCACCTGCAGGCTTAATGGGGG + Intergenic
1138331534 16:56219439-56219461 CACAGCAGAAAGCTTCTTGGGGG + Intronic
1139507822 16:67408091-67408113 CCCATCTCAAAGCTAAATGGAGG + Intronic
1140353971 16:74288383-74288405 CACAGTTGATAGCTCAATGAAGG - Intergenic
1140428942 16:74885016-74885038 CTCAGCTGTAAGCTCCATGGGGG + Intronic
1140535699 16:75707505-75707527 TACAGAAGAAAGCTTAATGATGG + Intronic
1140902881 16:79386023-79386045 CAGAGCTTAGAGCTTAAGGGAGG + Intergenic
1142948199 17:3453529-3453551 CACAGCTAACATCATAATGGGGG + Intronic
1144297130 17:13886761-13886783 CTCAACTGAAAGCTTAATGTAGG - Intergenic
1149576062 17:57714461-57714483 AACAGCTCAAGGCTTCATGGAGG + Intergenic
1149827382 17:59841999-59842021 CACAGCTGAACACTTAAAAGAGG - Intronic
1153400318 18:4678136-4678158 CTCATCTGAAAGCTCAATTGGGG + Intergenic
1154512743 18:15125800-15125822 CACAGCTGAGAGTTTTATGCTGG - Intergenic
1155172937 18:23280607-23280629 AAGAGCTGAAAGCTTAAAGTGGG + Intronic
1157119362 18:44894828-44894850 CACTGTTGAAAACTTAATTGAGG + Intronic
1158283347 18:55851537-55851559 TAAAGCTGAAGCCTTAATGGAGG + Intergenic
1160220060 18:76969004-76969026 GACAGCTGAATCCTTATTGGTGG - Exonic
1164745724 19:30611295-30611317 CACAGCTGAAATCTCAAGTGAGG + Intronic
926419323 2:12681530-12681552 CAGAGCTGCAATTTTAATGGAGG + Intergenic
929341857 2:40829291-40829313 TAGAGCTGAAAGCTTAATGCTGG - Intergenic
932385070 2:71324648-71324670 GTCAACTGAAAGCTTAATTGAGG + Intronic
936025915 2:109031218-109031240 CACTGCTGACACCTTGATGGTGG - Intergenic
937075541 2:119103432-119103454 AAGGGTTGAAAGCTTAATGGAGG - Intergenic
939581583 2:143955886-143955908 CACAGCTGGCAGCTGAATGCAGG - Intronic
939901661 2:147858024-147858046 CACAAGTGAAAGCTAAATGATGG - Intronic
944350040 2:198715607-198715629 TTCAGCTGGGAGCTTAATGGGGG + Intergenic
944425784 2:199581750-199581772 AACAGATGAAAGAATAATGGAGG - Intergenic
947093231 2:226537151-226537173 CACAGCTGAAAGCTTTTCAGTGG + Intergenic
947129721 2:226909014-226909036 CACACCTGGAAGCTAGATGGAGG + Intronic
947166611 2:227268527-227268549 CAAAGATGAAAGACTAATGGCGG + Intronic
947271443 2:228340774-228340796 CTCAGCTGAAAACTCAAGGGGGG + Intergenic
947789413 2:232855358-232855380 GACAGCTGAAAACCTAATGCTGG - Intronic
948089351 2:235279541-235279563 CTCACCTGAAAGCTCAATGGGGG + Intergenic
1169475521 20:5928015-5928037 CACAGTTGGCAGCTTAATGGTGG + Intergenic
1172524735 20:35592526-35592548 GATAGCTGAAAGCCTAGTGGGGG - Intergenic
1177222326 21:18210238-18210260 CACAGCAGAAAGCAACATGGAGG - Intronic
1178739939 21:35189667-35189689 CACAGTTGAAAGCTCCATGTGGG + Intronic
1179461506 21:41538483-41538505 CACAGCAGAAAGCTCTAAGGAGG + Intergenic
1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG + Intergenic
1182867299 22:33614783-33614805 CACAGCTGACAGTCTCATGGAGG - Intronic
949301360 3:2587628-2587650 CATAGCTGAAATCATAAGGGAGG - Intronic
951774354 3:26292760-26292782 CAGAGCTGAAAGCTGACTGTAGG - Intergenic
953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG + Intronic
962335776 3:134528531-134528553 CACTACTGAAAGCTTAAGGAGGG + Intronic
968044676 3:195617343-195617365 CACAGCTGGAAGCCCAAAGGTGG - Intergenic
968060464 3:195723394-195723416 CACAGCTGGAAGCCCAAAGGTGG - Intronic
968247645 3:197169356-197169378 TCCAGCTGAAAGGTTATTGGTGG + Intronic
970934490 4:21553124-21553146 AACATCTGAAAGCTTAAAGGGGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
974105049 4:57460459-57460481 CTCATCTGAAAGCTCAATGAGGG - Intergenic
976591027 4:86850082-86850104 CACAGCAGAAAGTTTATTTGTGG + Intergenic
978672322 4:111264673-111264695 CACAGCTGAATGCTTATGGTAGG - Intergenic
981472703 4:145154817-145154839 CACTGCTGAATGTTCAATGGTGG + Intronic
985809987 5:2075712-2075734 CACTGCTGAGAGCTGAGTGGAGG - Intergenic
986031610 5:3899456-3899478 AACATCTGAAACTTTAATGGAGG - Intergenic
987253573 5:16125221-16125243 CACTGCTGATAGCTTATTGATGG + Intronic
988854158 5:35211091-35211113 CACACCGGAAAGCTTAACTGCGG + Intronic
989053458 5:37343950-37343972 CACTGTTGAAAGCTTCATTGAGG - Intronic
989161241 5:38393777-38393799 CACAGCTGAAAGAGCATTGGTGG - Intronic
989670112 5:43906816-43906838 CTCATCTGAAAGCTCAATTGAGG - Intergenic
993584257 5:89703428-89703450 GACAGCTTAAAGTTTAATGGAGG - Intergenic
996202430 5:120692786-120692808 CCCTGCTAAAAGCTTAGTGGGGG + Intergenic
996753814 5:126915652-126915674 CACAGCACAAAGCTGAGTGGTGG + Intronic
1000209731 5:159098184-159098206 CTCAGCTGGTGGCTTAATGGGGG + Intronic
1004022247 6:11786557-11786579 CTCAGCTGAGAGTTTAATGATGG - Intronic
1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG + Intronic
1005801242 6:29427293-29427315 CACAGCTGAATGCTTACTGCTGG - Exonic
1008000441 6:46354474-46354496 CACTGGAGAAAGCTGAATGGAGG + Intronic
1008805365 6:55420234-55420256 TAAAGCTGAAAGCCAAATGGAGG + Intergenic
1009901698 6:69815010-69815032 CAGAGTAGAAAGCCTAATGGTGG - Intergenic
1011230462 6:85155570-85155592 CACAGCAGTAAGCACAATGGCGG + Intergenic
1011304908 6:85915225-85915247 CCAAGCTGAAAGCTTAGAGGTGG + Intergenic
1011990611 6:93511109-93511131 CACAGCTGAAAACTATATGGCGG - Intergenic
1017218725 6:151940781-151940803 CCAAGCTGAAAACTTGATGGAGG + Intronic
1018034266 6:159867862-159867884 CACTGCTGATAGCTTAGTGTTGG + Intergenic
1020132608 7:5567797-5567819 CTCAGCTGCAAGCTGTATGGGGG - Intergenic
1022345514 7:29510454-29510476 CACTCCTGAAGGCTTGATGGTGG + Intronic
1024554900 7:50595096-50595118 CACAGCTGAAAGGGTACTGATGG - Intronic
1025836672 7:65100709-65100731 CAAAGTTCAAAGCTTAATGCCGG - Intergenic
1025906446 7:65790146-65790168 CAAAGTTCAAAGCTTAATGCTGG - Intergenic
1027701043 7:81470470-81470492 CAAAGCTGCAAGCTCAATGGAGG + Intergenic
1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG + Intronic
1030231488 7:107212618-107212640 CACAGTTTAAAGCTTTATAGAGG + Intronic
1032650222 7:133869806-133869828 CACAGCTGAAAGCCTCAGGTTGG - Intronic
1037828610 8:22175131-22175153 CACAACGGAAAGCTGCATGGAGG + Intronic
1042417682 8:68542673-68542695 CTCAGTTGAAAGCTTTATGTTGG - Intronic
1043250976 8:78072569-78072591 CACAGTAGAAAGCTTTATGAGGG + Intergenic
1044645370 8:94436903-94436925 CAGAGCTGAAGGCTGCATGGTGG - Exonic
1047930535 8:129724201-129724223 GTCACCTGAAAGCTTAATTGAGG - Intergenic
1048284333 8:133129968-133129990 GACATCTGAAAGCTTAAGAGTGG - Intronic
1049464754 8:142745860-142745882 CTGAGTTGAAAGCTTGATGGAGG - Intergenic
1054870683 9:70044825-70044847 CACAGCTGAGGGCTTGAAGGAGG - Intronic
1055713994 9:79097526-79097548 CACAGGTGAGAGCTAAATGATGG - Intergenic
1057078105 9:92151199-92151221 CACAGCTGAACACTTAAAAGAGG - Intergenic
1057094261 9:92291451-92291473 CACATCTGAAAAATTAATGAGGG - Intronic
1059465490 9:114466617-114466639 CACAGCTGCAAGTGTAGTGGGGG + Intronic
1186432582 X:9517596-9517618 CAGATCTGCAAGCTGAATGGTGG + Intronic
1187558608 X:20377526-20377548 CACTGCTGAGAGCTTATAGGAGG + Intergenic
1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG + Intergenic
1192659408 X:73026656-73026678 CACAACTGAGAGCTTAATCAGGG - Intergenic
1195606690 X:106813551-106813573 TACTGTTGAAAGATTAATGGTGG - Intronic
1196573942 X:117296550-117296572 CACAGCTGAAAGTTGAATGTGGG - Intergenic
1196999415 X:121422247-121422269 CCCAGCTGAAAGCATATTGAAGG + Intergenic
1199227252 X:145392330-145392352 AACAGCTGAAAACTTCATGATGG - Intergenic
1201867880 Y:18673800-18673822 CACAGCTGAAAGGCTGCTGGAGG - Intergenic