ID: 1117301404

View in Genome Browser
Species Human (GRCh38)
Location 14:54432202-54432224
Sequence GGTACTCTGGGAGTACAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117301399_1117301404 24 Left 1117301399 14:54432155-54432177 CCACTCTGCTGCACAAAGAAACA 0: 1
1: 1
2: 1
3: 33
4: 306
Right 1117301404 14:54432202-54432224 GGTACTCTGGGAGTACAAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117301404 Original CRISPR GGTACTCTGGGAGTACAAGC TGG Exonic
900752586 1:4408090-4408112 GGTAGGCTGGGAGAACCAGCTGG - Intergenic
901383059 1:8887950-8887972 GGCACTTTGGGAGGCCAAGCTGG - Intergenic
901561088 1:10071332-10071354 AGTACTCTGGGAGGCCAAGGTGG + Intronic
901705017 1:11067047-11067069 AGTACTCTGGGAGGCCAAGGCGG + Intronic
901726717 1:11248562-11248584 GGTACTTTGGGAGGCCAAGGTGG + Intronic
901985534 1:13072817-13072839 GGTACTTTGGGAGGCCAAGGGGG + Intronic
901996275 1:13153950-13153972 GGTACTTTGGGAGGCCAAGGGGG - Intergenic
902610944 1:17596791-17596813 AGTACTTTGGGAGTACTAGGCGG + Intronic
903094485 1:20956849-20956871 AGTACTTTGGGAGGCCAAGCTGG - Intronic
903106160 1:21082041-21082063 GGTACTTTGGGAGGCCAAGGTGG - Intronic
905165658 1:36081637-36081659 AGTACTTTGGGAGGCCAAGCTGG + Intergenic
905408937 1:37755045-37755067 GGCACTTTGGGAGACCAAGCTGG - Intronic
905640578 1:39586952-39586974 GGTACTTTGGGAGGCCAAGACGG - Intergenic
906446587 1:45904711-45904733 AGCACTCTGGGAGGCCAAGCAGG - Intronic
907296086 1:53455686-53455708 GGGACTCTGGGAAAAAAAGCTGG + Intergenic
907348982 1:53810655-53810677 AGTACTCTGGGAGGCCAAGGTGG + Intronic
908202033 1:61807422-61807444 AGAACTCTGGGAGGCCAAGCAGG - Intronic
908303030 1:62781134-62781156 AGTACTTTGGGAGTCCAAGGCGG - Intergenic
909796728 1:79748746-79748768 AGTACTCTGGGAGGCCAAGGCGG - Intergenic
910248657 1:85170345-85170367 GGTACTCTGGGAGAATAAGGTGG - Intronic
910356769 1:86366304-86366326 AGTACTTTGGGAGGACAAGGTGG + Intronic
911986906 1:104638232-104638254 AGTACTTTGGGAGTCCAAGCGGG + Intergenic
912874844 1:113347349-113347371 AGCACTCTGGGAGGCCAAGCAGG - Intergenic
912920100 1:113858303-113858325 TGTACTCTGGGAGGCCAAGAGGG - Intronic
914003793 1:143715412-143715434 AGTACTCTGGGAGGCCAAGATGG + Intergenic
914220326 1:145675767-145675789 AGCACTTTGGGAGTACAAGGTGG + Intronic
914472905 1:147998630-147998652 AGCACTTTGGGAGTACAAGGTGG + Intergenic
915222028 1:154382558-154382580 AGCACTTTGGGAGTACAAGGGGG - Intergenic
916372230 1:164111264-164111286 GGTATTCTGTAAGTACAAGTGGG + Intergenic
916690470 1:167185435-167185457 GGTACTTTGGGAGGCCAAGGTGG + Intergenic
916969128 1:169991089-169991111 AGCACTTTGGGAGGACAAGCGGG + Intronic
917045296 1:170853024-170853046 GCAACTTTGGAAGTACAAGCGGG - Intergenic
918643232 1:186870135-186870157 GGTATTCTAGGAGCACAATCAGG - Intronic
919720800 1:200832946-200832968 AGTACTTTGGGAGGACAAGGTGG + Intronic
920228166 1:204452903-204452925 CGTACTTTGGGAGGACAAGGCGG - Intronic
921173954 1:212576976-212576998 GGTACTTTGGGAGGCCAAGGCGG - Intronic
922662578 1:227443058-227443080 AGTACTCTGGGAGGCCAAGGCGG + Intergenic
924564680 1:245187100-245187122 GGCACTTTGGGAGTCCAAGGCGG - Intronic
924687171 1:246306209-246306231 GGGACTATGGGACTACAGGCAGG - Intronic
924857298 1:247886634-247886656 GGCACTTTGGGAGTCCAAGATGG + Intergenic
1064222608 10:13454922-13454944 AGTACTCTGGGAGGCCAAGGCGG + Intronic
1064410476 10:15099724-15099746 AGCACTTTGGGAGGACAAGCTGG - Intronic
1064444623 10:15382461-15382483 AGTACTTTGGGAGGCCAAGCCGG - Intergenic
1065640945 10:27782143-27782165 AGTACTTTGGGAGGCCAAGCTGG - Intergenic
1065962556 10:30745737-30745759 AGTACTCTGGGAGGCCAAGGCGG - Intergenic
1066311014 10:34196818-34196840 GGCACTCTGGGAGGCCAAGGTGG - Intronic
1066632769 10:37472790-37472812 TGTACTTTGGGAGTATAAGGTGG + Intergenic
1067782775 10:49221132-49221154 TATTCTCTGGGAGTACAAGACGG + Intergenic
1068755989 10:60653620-60653642 AGTACTTTGGGAGGACAAGGTGG + Intronic
1069009922 10:63361173-63361195 GGCACTTTGGGAGGACAAGCTGG + Intronic
1069409771 10:68141121-68141143 AGCACTCTGGGAGGACAAGGCGG + Intronic
1069418070 10:68219579-68219601 GGTACTTTGGGAGCACATGGAGG - Intergenic
1069579619 10:69556734-69556756 GGGACTCTGGGAATTCAAGTAGG - Intergenic
1070202028 10:74216475-74216497 AGTACTTTGGGAGGACAAGGTGG + Intronic
1070763923 10:79045594-79045616 AGTACTCTGGAAGGAGAAGCAGG + Intergenic
1071248180 10:83787520-83787542 AGTACTTTGGGAGTCCAAGGAGG - Intergenic
1071541614 10:86489965-86489987 GGTACTTTGGGAGGCCAAGGTGG + Intronic
1071700026 10:87921514-87921536 AGTACTCTGGGAGGCCAAGGCGG - Intronic
1072470098 10:95705847-95705869 GGCACTTTGGGAGTCCAAGGTGG + Intergenic
1073549091 10:104380899-104380921 AGCACTCTGGGAGTCCAAGGGGG + Intronic
1074773726 10:116750726-116750748 AGCACTCTGGGAGGCCAAGCGGG + Intergenic
1076838768 10:133034295-133034317 GGTACTCAGGCAGAAAAAGCAGG + Intergenic
1078214311 11:9298515-9298537 AGTACTTTGGGAGGACAAGGTGG + Intronic
1080332618 11:31157129-31157151 GGCACTTTGGGAGGCCAAGCTGG + Intronic
1080436259 11:32247727-32247749 AGCACTCTGGGAGTTCAAGGAGG - Intergenic
1080545234 11:33310554-33310576 AGTACTCTGGGAGGCCAAGCTGG - Intronic
1080677468 11:34440808-34440830 GGTACTTTGGGAGGCCAAGGCGG - Intronic
1081605195 11:44522991-44523013 GGTGCTCTGGGAGGAAAAACAGG + Intergenic
1082824772 11:57569407-57569429 GGTACTCTGGGAGTATGAGGAGG + Intergenic
1082843517 11:57709132-57709154 GGCACTCTGGGAGGCCAAGGTGG + Intronic
1083461589 11:62816526-62816548 AGTGCTCTGGGAGTTCAAGGCGG - Intronic
1083884874 11:65568062-65568084 AGCACTCTGGGAGGACATGCAGG - Intergenic
1084065784 11:66703483-66703505 AGTACTTTGGGAGGCCAAGCCGG + Intronic
1084808104 11:71593489-71593511 GATCCTCTGGGAGTCCAAGGAGG - Intronic
1084830154 11:71762609-71762631 AGGACTCTGGGAGTCCAAGATGG + Intergenic
1084865528 11:72053231-72053253 AGTGCTCTGGGAGGACAAGGTGG - Intronic
1085084668 11:73658974-73658996 GGTACTTTGGGAGGCCAAGGCGG + Intronic
1085186834 11:74582883-74582905 AGAACTCTGGGAGGACAAGGTGG + Intronic
1086754481 11:90542605-90542627 GGCACTTTGGGAGGACAAGATGG + Intergenic
1089160976 11:116437090-116437112 AGTACTTTGGGAGTCCAAGGTGG - Intergenic
1089549068 11:119256426-119256448 AGCACTCTGGGAGTCCAAGGTGG - Intronic
1089746804 11:120623378-120623400 AGTACTTTGGGAGTCCAAGGCGG - Intronic
1090015104 11:123079023-123079045 AGCACTCTGGGAGGCCAAGCTGG - Intronic
1090294299 11:125573151-125573173 GGCACTTTGGGAGGACAAGGCGG - Intronic
1091204401 11:133809870-133809892 GGTACTATGGGATGACAGGCGGG - Intergenic
1091221722 11:133933634-133933656 GCTACTCTGGAAGTTGAAGCGGG + Intronic
1091268874 11:134291725-134291747 AGTGCTTTGGGAGTACAAGGCGG + Intronic
1093585078 12:20825546-20825568 GGTACTTTGGGAGGCCAAGGCGG + Intronic
1095122338 12:38434306-38434328 GGTACTTTGGGAGGCCAAGGTGG + Intergenic
1095995038 12:48074957-48074979 AGCACTTTGGGAGGACAAGCGGG + Intronic
1096000888 12:48129306-48129328 AGTACTTTGGGAGGTCAAGCTGG - Intronic
1097627156 12:62014379-62014401 GGTACTTTGGGAGGCCAAGGCGG + Intronic
1097833524 12:64250555-64250577 AGTACTCTGGGAGGCCAAGGAGG - Intergenic
1099460768 12:82918155-82918177 AGTACTTTGGGAGGCCAAGCTGG - Intronic
1100578646 12:95917623-95917645 GGTGCTTTGGGAGTCCAAGGCGG + Intronic
1100815110 12:98379379-98379401 GTTGCTCTGGCAGTACATGCTGG - Intergenic
1101934680 12:109047738-109047760 GGTACTTTGGGAGGCCAAGGTGG + Intronic
1102177173 12:110884621-110884643 AGTACTTTGGGAGTCCAAGGTGG - Intronic
1102194574 12:111015854-111015876 AGTACTCTGGGAGGCCAAGGCGG + Intergenic
1102228782 12:111248146-111248168 GGCACTCTGGGAGGCCAAGGTGG - Intronic
1102340727 12:112119618-112119640 GGTACTTTGGGAGACCAAGGTGG + Intergenic
1102380536 12:112462108-112462130 AGTACTTTGGGAGGACAAGAAGG + Intronic
1102887164 12:116530899-116530921 AGCACTCTGGGAGGCCAAGCGGG - Intergenic
1103378753 12:120477661-120477683 GCTACTCTGGAGGTAGAAGCGGG + Intronic
1104237006 12:126948658-126948680 GGCACTTTGGGAGGCCAAGCGGG + Intergenic
1105041104 12:132962086-132962108 AGTACTCTGGGAGGCCAAGTCGG - Intergenic
1105508146 13:21028813-21028835 AGTACTCTGGGAGGCCAAGGCGG - Intronic
1105697422 13:22902640-22902662 AGTACTTTGGGAGGCCAAGCTGG - Intergenic
1105807929 13:23968438-23968460 AGTACTCTGGGAGGCCAAGGTGG - Intergenic
1106392309 13:29346648-29346670 GGTGATCTGGGAGTACAGACAGG - Intronic
1107009308 13:35652391-35652413 AGTACTTTGGGAGTCCAAGACGG + Intronic
1108679212 13:52764968-52764990 AGTACTTTGGGAGGCCAAGCCGG + Intergenic
1108855311 13:54786249-54786271 GGTTCCCTGGGAGCCCAAGCAGG - Intergenic
1110524934 13:76525252-76525274 GGCACTTTGGGAGGCCAAGCCGG + Intergenic
1110864963 13:80383292-80383314 AGTACTCTGGGAGGACTAGGTGG + Intergenic
1113015495 13:105823997-105824019 AGTACTCTGGGAGGTCAAGGTGG + Intergenic
1113261849 13:108573623-108573645 TGTAGTCTGGGAGTAGAAGCAGG + Intergenic
1116472972 14:45306528-45306550 GGCACTCAGGGACTGCAAGCAGG + Intergenic
1117128327 14:52656811-52656833 AGTACTCTGGGAGGCCAAGATGG + Intronic
1117301404 14:54432202-54432224 GGTACTCTGGGAGTACAAGCTGG + Exonic
1117364618 14:55013656-55013678 AGCACTTTGGGAGTACAAGGTGG + Intronic
1118353692 14:64993074-64993096 TGTACTTTGGGAGTCCAAGGTGG - Intronic
1118582425 14:67315676-67315698 GGCACTTTGGGAGGCCAAGCAGG + Intronic
1119297656 14:73546226-73546248 GGCACTTTGGGAGGCCAAGCCGG - Intronic
1119301886 14:73578096-73578118 GGCACTTTGGGAGGCCAAGCTGG - Intergenic
1120594091 14:86412959-86412981 GGTATTCTGGAAGTACAATGTGG - Intergenic
1120748054 14:88169618-88169640 CGCACTTTGGGAGTCCAAGCAGG - Intergenic
1121361458 14:93264851-93264873 AGCACTCTGGGAGTCCAAGGCGG + Intronic
1121512509 14:94522799-94522821 GGTTCTCTGGAAGCAGAAGCTGG - Intergenic
1121686911 14:95842510-95842532 AGTACTTTGGGAGGCCAAGCTGG - Intergenic
1121756038 14:96402880-96402902 AGTACTTTGGGAGGCCAAGCGGG + Intronic
1122363091 14:101179015-101179037 AGCACTCTGGGAGTCCAAGGCGG + Intergenic
1122754454 14:103967253-103967275 GATACTCTGGGAGGCCAAGGTGG + Intronic
1122944663 14:105001691-105001713 AGGACTCTGGGAGGCCAAGCTGG + Intronic
1123012089 14:105354347-105354369 GGCACTTTGGGAGGCCAAGCTGG - Intronic
1123449221 15:20349773-20349795 GGTACCCTGGGGGTACAGGTAGG - Intergenic
1123540338 15:21283418-21283440 GGTGCTCTGTGAGTGCTAGCTGG - Intergenic
1125432418 15:39609091-39609113 GAAACACTGGGAGTACAGGCAGG + Intronic
1125618064 15:41033802-41033824 AGTACTCTGGGAGGCCAAGGCGG + Intronic
1125658623 15:41378536-41378558 AGTACTCTGGGAGGCCAAGGCGG + Intronic
1125912333 15:43452316-43452338 GGCACTCTGGGAGGCCAAGGTGG + Intronic
1125956013 15:43791789-43791811 GGGACAATGGGAGTAGAAGCGGG + Intronic
1126334304 15:47569811-47569833 AGTACTTTGGGAGAACAAGGCGG + Intronic
1126754641 15:51914047-51914069 AGTACTTTGGGAGACCAAGCAGG + Exonic
1126835576 15:52660899-52660921 GGTACTTTGGGAGACCAAGGCGG - Intronic
1127593271 15:60449690-60449712 GGTACTGTGGAAGTACTTGCTGG + Exonic
1128178204 15:65575843-65575865 AGTACTTTGGGAGGCCAAGCTGG + Intronic
1128992858 15:72274952-72274974 AGTACTTTGGGAGGACAAGATGG - Intronic
1129022668 15:72536341-72536363 AGCACTGTGGGAGGACAAGCTGG - Intronic
1129420288 15:75419570-75419592 AGTACTCTGGGAGGCCAAGGAGG + Intronic
1129754744 15:78091125-78091147 AGTACTTTGGGAGCACAAGGTGG - Intronic
1130586254 15:85185508-85185530 GGCACTTTGGGAGTCCAAGGTGG - Intergenic
1131178826 15:90226586-90226608 GGCACTCTGGGAGCCCAAGGTGG - Intronic
1202948650 15_KI270727v1_random:10566-10588 GGTGCTCTGTGAGTGCTAGCTGG - Intergenic
1132682884 16:1150859-1150881 GGGCCTCTGTGAGGACAAGCCGG - Intergenic
1132998110 16:2834549-2834571 AGTACTTTGGGAGGCCAAGCCGG + Intronic
1133600743 16:7337928-7337950 AGTACTCTGGGAGGCCAAGGCGG - Intronic
1134296316 16:12949180-12949202 TGTATTATGGGAGTACTAGCAGG + Intronic
1136096197 16:27958920-27958942 AGCACTTTGGGAGTACAAGGCGG - Intronic
1136414404 16:30095017-30095039 GGAACTCTGGGAGTCTCAGCAGG + Intronic
1137697367 16:50470081-50470103 GGCACGCTGGGAGTGCCAGCAGG - Intergenic
1138594732 16:58023824-58023846 GGTACTTTGGGAGTCCAAGGTGG - Intergenic
1139077829 16:63475551-63475573 AGTACTTTGGGAGTTCAAGGCGG - Intergenic
1139372397 16:66477226-66477248 GGGACTGTGGGAGTAAAGGCAGG - Intronic
1139407009 16:66727163-66727185 AGTACTCTGGGAGGCCAAGGTGG - Intronic
1139450012 16:67021955-67021977 AGTACTTTGGGAGGACAAGGCGG - Intergenic
1139539481 16:67603575-67603597 GGTACTTTGGGAGGCCAAGGCGG + Intronic
1141745137 16:85920483-85920505 AGTACTTTGGGAGGCCAAGCTGG - Intronic
1142662726 17:1442397-1442419 AGTACTCTGGGAGGCCAAGGTGG - Intronic
1142856869 17:2735676-2735698 GGCACTCTGGGAGGCCAAGGCGG - Intergenic
1144699423 17:17327159-17327181 AGCACTCTGGGAGGACAAGATGG - Intronic
1145107500 17:20131424-20131446 GGCACTCTGGGAGGTCAAGGTGG - Intronic
1147407152 17:40220222-40220244 AGCACTCTGGGAGTCCAAGGTGG - Intronic
1148437237 17:47694158-47694180 GGTAAGCTGCGATTACAAGCAGG + Intronic
1148490526 17:48021035-48021057 AGTACTTTGGGAGGACAAGGTGG - Intergenic
1149619863 17:58036011-58036033 AGCACTTTGGGAGGACAAGCTGG + Intergenic
1149956824 17:61060380-61060402 AGCACTCTGGGAGGCCAAGCGGG - Intronic
1150129450 17:62659290-62659312 AGTACTCTGGGAGGCCAAGGTGG + Intronic
1150144461 17:62755999-62756021 AGTACTCTGGGAGGCCAAGGTGG + Intronic
1150887673 17:69106343-69106365 AGTACTCTGGGAGACCAAGGTGG + Intronic
1151755060 17:76069963-76069985 GGTACTCTGGAGGCAGAAGCAGG + Intronic
1152705268 17:81840402-81840424 AGTACTCTGGGAGGCCAAGGTGG + Intergenic
1152826698 17:82470739-82470761 AGTACTTTGGGAGTCCAAGGCGG - Intronic
1153215638 18:2818016-2818038 AGTACTTTGGGAGGACAAGATGG + Intergenic
1155140426 18:23039695-23039717 AGCACTCTGGGAGTCCAAGGTGG + Intergenic
1155483362 18:26313913-26313935 AGTACTCTGGGAGGCCAAGGTGG - Intronic
1156312755 18:35940030-35940052 AGTGCTCTGGGAGTCCATGCTGG - Intergenic
1157177915 18:45467984-45468006 GATTCTCTGGGAATACAGGCAGG - Intronic
1157670081 18:49520857-49520879 AGCACTCTGGGAGAACAAGTTGG - Intergenic
1158259770 18:55593652-55593674 GGGACTCGGGGAGAACAAACTGG - Intronic
1158687490 18:59627963-59627985 GGTACTTTGGGAGGCCAAGGTGG + Intronic
1158783244 18:60677381-60677403 AGCACTCTGGGAGGACAAGGCGG - Intergenic
1158953285 18:62517443-62517465 AGTACTTTGGGAGGCCAAGCGGG - Intergenic
1161512721 19:4680466-4680488 AGTACTTTGGGAGGCCAAGCTGG + Intronic
1161584190 19:5096330-5096352 AGTACTCTGGGAGGCCAAGGCGG - Intronic
1161690746 19:5732216-5732238 AGCACTCTGGGAGAACAAGACGG - Intronic
1161761661 19:6177591-6177613 GGCACTCTGGGAGGCCAAGACGG + Intronic
1162409365 19:10495935-10495957 GGTACTTTGGGAGACCAAGGCGG + Intronic
1162727291 19:12697460-12697482 GGTACTTTGGGAGACCAAGTTGG - Intergenic
1162881583 19:13663738-13663760 AGCACTCTGGGAGTCCAAGGTGG + Intergenic
1163032017 19:14550917-14550939 AGTACTCTGGGAGGCCAAGGTGG - Intronic
1163147993 19:15395277-15395299 GGCACTTTGGGAGGACAAGGTGG - Intronic
1163245713 19:16092781-16092803 AGTACTCTGGGAGGCCAAGGCGG - Intronic
1163523015 19:17803251-17803273 GGTACTTTGGGAGGTCAAGGAGG - Intronic
1163721882 19:18901930-18901952 AGTACTTTGGGAGTCCAAGGTGG + Intronic
1164567787 19:29340270-29340292 AGTACTCTGGGAGGCCAAGGAGG + Intergenic
1166089588 19:40499642-40499664 GGCACTCTGGGAGGCCAAGGTGG - Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166740561 19:45112467-45112489 GAGACTCTTGGAGAACAAGCAGG - Intronic
1166813926 19:45530240-45530262 GCTACTCTGGAAGTTGAAGCAGG + Intronic
1167202938 19:48079722-48079744 GGCACTCTGGGAGGCCCAGCTGG + Intronic
1167946226 19:52991302-52991324 AGTACTTTGGGAGTCCAAACAGG + Intergenic
1168394149 19:56034015-56034037 AGTGCTCTGGGAGGCCAAGCGGG - Intronic
925397864 2:3549599-3549621 GGCACTTTGGGAGGACAAGGTGG + Intronic
926028589 2:9565999-9566021 AGTACTCTGGGAGGCCAAGGTGG + Intergenic
926179229 2:10625924-10625946 AGTACTCTGGGAGGCCAAGATGG + Intronic
927171895 2:20377508-20377530 GGTACTTTGGGAGGCCAAGATGG - Intergenic
928309356 2:30196803-30196825 GGCACTCTGGGAGGCCAAGGTGG + Intergenic
930066353 2:47330780-47330802 AGCACTCTGGGAGTTCAAGGTGG - Intergenic
930133795 2:47880242-47880264 GGCACTCTGGGAGGCCAAGTTGG - Intronic
930191784 2:48467034-48467056 GTTACACTGTGAGTACAATCAGG - Intronic
930330380 2:49976278-49976300 GGTACTTTGGGAGGCCAAGGTGG - Intronic
931294366 2:60907165-60907187 AGTACTCTGGGAGGCCAAGGTGG - Intronic
932691095 2:73914310-73914332 AGTACTTTGGGAGGCCAAGCAGG + Intronic
932766808 2:74475576-74475598 GGAACTCTGGAAGGAGAAGCTGG + Intronic
934580294 2:95432416-95432438 GGAACTGTGGGAGTACAGGTTGG - Intergenic
934976954 2:98809381-98809403 GGGGCTCTGGGAGCACAAGTGGG + Intronic
935411891 2:102772607-102772629 GGTTCTATGGGGGTACAAGCTGG + Intronic
936532502 2:113286296-113286318 GGAACTGTGGGAGTACAGGTTGG + Intergenic
939410508 2:141818781-141818803 AGTACTCTGGGAGGCCAAGGCGG - Intronic
939755024 2:146099792-146099814 TGTACTCTGGGAGGGCGAGCAGG - Intergenic
939884991 2:147671760-147671782 AGTACTTTGGGAGGCCAAGCTGG - Intergenic
941221347 2:162785993-162786015 AGTACTTTGGGAGGCCAAGCTGG + Intronic
941397548 2:164991946-164991968 GGTGCTCTGTGAGTGCTAGCTGG - Intergenic
941832248 2:169974932-169974954 AGCACTTTGGGAGTCCAAGCGGG + Intronic
941968712 2:171326753-171326775 GGTACTAAGGGAGTACAAATGGG - Intronic
941995863 2:171601471-171601493 GGCACTTTGGGAGTCCAAGATGG + Intergenic
942035900 2:172010391-172010413 AGTACTCTGGGAGGCCAAGGTGG - Intronic
944235883 2:197441087-197441109 AGCACTTTGGGAGTACAAGGAGG + Intergenic
944754387 2:202744724-202744746 AGCACTTTGGGAGTACAAGGTGG + Intronic
945807750 2:214511037-214511059 GGTACTTTGGGAGGCCAAGGCGG + Intronic
946219334 2:218213056-218213078 AGTACTTTGGGAGGATAAGCAGG - Intergenic
946244213 2:218376961-218376983 AGTACTTTGGGAGTCCAAGATGG - Intergenic
946634327 2:221707737-221707759 GGTACTTTGGGAGGCCAAGGCGG - Intergenic
948306174 2:236948422-236948444 AGTACTCTGGGAGGCCAAGTCGG + Intergenic
948410200 2:237753546-237753568 GGTACTTTGGGAGGCCAAGGTGG + Intronic
1172452130 20:35033742-35033764 GGCACTCTGGGAGGCCAAGGAGG + Intronic
1172487789 20:35309183-35309205 AGCACTTTGGGAGTCCAAGCTGG + Intronic
1172744442 20:37195771-37195793 GCTACTCAAGGAGTCCAAGCAGG - Intronic
1173275406 20:41576436-41576458 GGTACTTTGGGAGGCCAAGGCGG + Intronic
1175247981 20:57592764-57592786 GGTGCAGTGGGAGAACAAGCGGG + Intergenic
1175960374 20:62633298-62633320 GGCACTCTGGGAGGCCAAGGCGG + Intergenic
1176313271 21:5166217-5166239 AGCACTCTGGGAGGCCAAGCGGG + Intergenic
1177561777 21:22764255-22764277 AGCACTCTAGGATTACAAGCCGG - Intergenic
1178368176 21:32005016-32005038 GGAACTTTGGGAGTCCAAGGCGG - Intronic
1178572978 21:33758128-33758150 AGTACTTTGGGAGGACAAGGTGG - Intronic
1178816610 21:35935876-35935898 AGCACTCTGGGAGGACAAGGTGG + Intronic
1178985889 21:37302755-37302777 AGCACTCTGGGAGGACAAGGCGG - Intergenic
1179675500 21:42978729-42978751 AGTACTCTGGGAGGCCAAGGTGG - Intronic
1179843777 21:44095813-44095835 AGCACTCTGGGAGGCCAAGCGGG - Intronic
1180168627 21:46044520-46044542 GGCACTTTGGGAGGACAAGGTGG + Intergenic
1180872682 22:19155683-19155705 AGCACTCTGGGAGGACAAGGTGG + Intergenic
1182433553 22:30315508-30315530 AGTACTCTGGGAGGCCAAGGTGG - Intronic
1182514355 22:30845181-30845203 AGTACTCTGGGAGGCCAAGGTGG + Intronic
1182562387 22:31170755-31170777 AGCACTTTGGGAGTACAAGGTGG - Intronic
1182871860 22:33654589-33654611 GACTCTCTGGGAGCACAAGCAGG + Intronic
1183195964 22:36353599-36353621 AGCACTCTGGGAGTCCAAGGCGG - Intronic
1183609973 22:38894156-38894178 AGCACTCTGGGAGGACAAGCAGG - Intergenic
1184152130 22:42645416-42645438 TGTGCTCTTGGAGGACAAGCGGG - Intronic
1184599915 22:45537369-45537391 GGTACTTTGGGAGGCCAAGGCGG + Intronic
1185360173 22:50401879-50401901 AGCACTCTGGGAGAACAAGGCGG - Intronic
951083797 3:18486006-18486028 AGTACTCTGGGAGGCCAAGATGG - Intergenic
953324768 3:42003617-42003639 AGCACTTTGGGAGTCCAAGCAGG + Intergenic
954174485 3:48833285-48833307 GGTACTTTGGGAGGCCAAGGTGG - Intronic
954268885 3:49491864-49491886 AGTACTCTGGGAGGCCAAGGCGG - Intronic
954784547 3:53083262-53083284 AGCACTTTGGGAGGACAAGCTGG + Intronic
955944751 3:64182238-64182260 AGCACTCTGGGAGGACAAGGTGG + Intronic
956968414 3:74491251-74491273 AGTACTTTGGGAGGCCAAGCTGG + Intronic
957157639 3:76565968-76565990 GGTACTCTGCCATTACCAGCTGG + Intronic
957797627 3:85031765-85031787 GGCACTCTGGGAGGCCAAGGCGG - Intronic
958096259 3:88949238-88949260 GGTACTGTGGAAGTACTTGCTGG - Intergenic
958547332 3:95571493-95571515 GGTACTCTAGGAAAACAAACAGG - Intergenic
960979723 3:123211703-123211725 AGTACTTTGGGAGGCCAAGCAGG - Intronic
961016515 3:123472545-123472567 AGTACTTTGGGAGGCCAAGCCGG - Intergenic
961183813 3:124897353-124897375 AGTACTTTGGGAGGGCAAGCAGG - Intronic
961548843 3:127655190-127655212 AGTACTTTGGGAGGCCAAGCGGG - Intronic
962513242 3:136124240-136124262 AGCACTCTGGGAGGACAAGTTGG + Intronic
963057036 3:141194284-141194306 GGCACTTTGGGAGGACAAGGCGG - Intergenic
966615135 3:181904951-181904973 AGTACTTTGGGAGGACAAGGTGG - Intergenic
966630527 3:182069462-182069484 GGTACTTTGGGAGGCCAAGGTGG - Intergenic
968017909 3:195356205-195356227 GCAACTGTGGGACTACAAGCCGG + Intronic
969316852 4:6387561-6387583 AGCACTTTGGGAGTCCAAGCCGG + Intronic
969784850 4:9448569-9448591 GGTACTTTGGGAGGCCAAGGCGG - Intronic
970010359 4:11452149-11452171 GGCACTTTGGGAGTCCAAGGTGG + Intergenic
971273972 4:25177976-25177998 AGTACTTTGGGAGGACAAGATGG + Intronic
971995056 4:33954912-33954934 TGGACTGTGGGAGCACAAGCTGG - Intergenic
972435296 4:39028002-39028024 AGTACTTTGGGAGGCCAAGCTGG - Intronic
973985686 4:56350205-56350227 AGTACTCTGGGAGGCCAAGGCGG + Intronic
974052306 4:56952422-56952444 TGTGCTCTGGCAGGACAAGCGGG + Intergenic
974915269 4:68171778-68171800 GGCACACTGATAGTACAAGCGGG - Intergenic
975857378 4:78639103-78639125 GGGACCCTGGGGGTACAAGTGGG - Intergenic
976496670 4:85738166-85738188 TGTACTCTGGGAGGCCAAGGTGG - Intronic
976643246 4:87361518-87361540 GGCACTCTGGGAGGCCAAGGCGG + Intronic
979230890 4:118347980-118348002 AGTACTCTGGGAGGCCAAGGCGG + Intronic
981048960 4:140292434-140292456 AGCACTCTGGGAGTCCAAGGTGG - Intronic
981481706 4:145245252-145245274 GGCACTTTGGGAGGCCAAGCGGG + Intergenic
982045647 4:151443009-151443031 GGCACTTTGGGAGGACAAGGTGG + Intronic
984202846 4:176747543-176747565 AGTACTTTGGGAGGCCAAGCTGG + Intronic
985303947 4:188519032-188519054 AGTACTCTGTGAGTACAAGCAGG - Intergenic
985852296 5:2397672-2397694 AGCACTCTGGGAGGACAAGGCGG - Intergenic
987151573 5:15046048-15046070 GGTACTCTGTGAATACATGGTGG + Intergenic
988030589 5:25758518-25758540 GGGACTCTGGGTTTCCAAGCTGG + Intergenic
988602440 5:32652304-32652326 GGCACTTTGGGAGGCCAAGCCGG - Intergenic
988927743 5:36006459-36006481 GATACAATGGGAGTACAGGCAGG + Intergenic
990301414 5:54452779-54452801 AGTACTTTGGGAGTCCAAGGTGG + Intergenic
992764728 5:79987190-79987212 AGTACTTTGGGAGATCAAGCGGG + Intronic
993751279 5:91671454-91671476 GGTTCTGTGGCAGTTCAAGCTGG - Intergenic
995365461 5:111355043-111355065 TGTGCTCTGGAAGTACAGGCAGG + Intronic
996756631 5:126943036-126943058 GGCACTCTGGGAGGCCAAGGCGG + Intronic
996994634 5:129680509-129680531 AGCACTCTGGGAGTCCAAGGTGG + Intronic
997168808 5:131692758-131692780 AGTACTCTGGGAGGCCAAGGTGG + Intronic
997929681 5:138061999-138062021 GGTACTTTGGGAGGCCAAGGTGG - Intergenic
998264065 5:140653848-140653870 AGTACTCTGGGAGGTCAAGGCGG - Intronic
998449768 5:142225312-142225334 GGTACTCTGGGAGGCCGAGGTGG - Intergenic
998521743 5:142807416-142807438 GGGCCTCTGGGAATACAATCTGG - Intronic
998723758 5:144985285-144985307 AGCACTCTGGGAGGCCAAGCTGG + Intergenic
999766643 5:154746043-154746065 GGCACTCTGGGAGTCCAAGGCGG - Intronic
999797382 5:155001327-155001349 AGCACTCTGGGAGGCCAAGCAGG - Intergenic
1000332273 5:160215264-160215286 GGCACTTTGGGAGGACAAGGTGG + Intronic
1003219709 6:4148372-4148394 AGTACTCTGGGAGGCCAAGATGG - Intergenic
1003282741 6:4708405-4708427 AGTACTTTGGGAGGACAAGGTGG - Intronic
1003553231 6:7117654-7117676 AGCACTCTGGGAGTCCAAGGTGG - Intronic
1004312072 6:14554698-14554720 GGCACTTTGGGAGGCCAAGCAGG - Intergenic
1004374742 6:15081431-15081453 AGTACTTTGGGAGACCAAGCGGG - Intergenic
1004393360 6:15227597-15227619 GGTGCTTTGGGGGGACAAGCGGG + Intergenic
1004649708 6:17597866-17597888 AGTACTTTGGGAGGACAAGGCGG + Intergenic
1004907744 6:20252452-20252474 AGCACTCTGGGAGGACAAGGCGG - Intergenic
1006784416 6:36655955-36655977 AGCACTTTGGGAGTACAAGGTGG + Intergenic
1010710030 6:79162838-79162860 GGAATTCTGGGAGGACAAGTGGG - Intergenic
1011367870 6:86601697-86601719 GGTACTCTGGGAGTGGCTGCTGG + Intergenic
1012574410 6:100774610-100774632 AGCACTCTGGGAGGCCAAGCTGG - Intronic
1014063713 6:117101712-117101734 AGCACTCTGGGAGGCCAAGCTGG - Intergenic
1014742562 6:125163332-125163354 GGTACTTTGGGAGGCCAAGACGG + Intronic
1014972443 6:127834321-127834343 AGTACTTTGGGAGGCCAAGCGGG + Intronic
1015256969 6:131188798-131188820 AGTACTCTGGGAGGCCAAGGAGG - Intronic
1015498064 6:133901639-133901661 TGTACTCTGGGAGGCCAAGGCGG + Intergenic
1015795149 6:137003944-137003966 GGAATTCTGGGGGTACAAGGAGG - Intronic
1016389994 6:143565369-143565391 GGCACTTTGGGAGTCCAAGGTGG + Intronic
1018877192 6:167832929-167832951 GGAACCCTGTGAGTACAAGTGGG + Intronic
1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG + Exonic
1020217499 7:6205323-6205345 GGAACTTTGGGAGTCCAAGGTGG + Intronic
1021443672 7:20709831-20709853 AGCACTCTGGGAGGACAAGGTGG + Intronic
1022984614 7:35639279-35639301 GCCACTCTGGGAGTCCAAGGCGG - Intronic
1024072409 7:45797244-45797266 AGCACTCTGGGAGGACAAGATGG - Intergenic
1024969236 7:55053531-55053553 GGAACTCTGGGAGTAGAACATGG - Intronic
1025096241 7:56097505-56097527 GGTACTCTGGACGTTGAAGCAGG + Intergenic
1026927805 7:74206073-74206095 GGCACTCTGGGAGGCCGAGCAGG + Intronic
1027874814 7:83755386-83755408 TGTACTCTGGGTGTAAAAGAAGG + Intergenic
1028143174 7:87293473-87293495 AGCACTTTGGGAGTACAAGGCGG + Intergenic
1030609206 7:111670330-111670352 GGTACTCTGAGATTAGAAACAGG - Intergenic
1032365133 7:131291855-131291877 GGCACTTTGGGAGGACAAGGCGG + Intronic
1032985070 7:137328685-137328707 GGACCGCTGGGAGTACAAGCAGG - Intronic
1032987131 7:137350235-137350257 AGCACTCTGGGAGTCCAAGGTGG + Intergenic
1033655033 7:143367457-143367479 AGTACTCTGGGAGACCAAGGCGG + Intergenic
1034855870 7:154546788-154546810 GTTCCTCTGGTAGTACAAACAGG - Intronic
1035427067 7:158785173-158785195 AGTACTCTGGGAGGCCAAGGTGG + Intronic
1035438039 7:158874004-158874026 AGTACTCTGGGAGGTCAAGGTGG - Intronic
1037238739 8:16752641-16752663 GGTACTTTGGGAGGCCAAGGAGG - Intergenic
1037456962 8:19073301-19073323 AGTACTCTGGGAGGCCAAGGCGG + Intronic
1038605680 8:29001300-29001322 GGTACTCTGGGAGGCCAAGGCGG + Intronic
1040027073 8:42791542-42791564 AGCACTCTGGGAGGCCAAGCAGG - Intronic
1040930089 8:52725084-52725106 AGTACTCTGGGAGGCCAAGACGG + Intronic
1041604936 8:59770355-59770377 AGGACTCTGGGAGGACAAGGTGG + Intergenic
1041903255 8:63005899-63005921 GGTACTTTGGGAGGCCAAGGTGG + Intergenic
1042142315 8:65691537-65691559 GGCACTTTGGGAGGACAAGATGG - Intronic
1042538148 8:69879996-69880018 AGCACTCTGGGAGGACAAGGTGG - Intergenic
1042971264 8:74411632-74411654 AGTACTTTGGGAGTCCAAGGTGG + Intronic
1043608096 8:82027332-82027354 AGCACTTTGGGAGGACAAGCGGG - Intergenic
1043664493 8:82791312-82791334 AGTACTTTGGGAGTTCAAGGTGG + Intergenic
1043700698 8:83284972-83284994 AGGACTCTGGGAGTCCAAGGTGG - Intergenic
1043839043 8:85079866-85079888 GGCACTTTGGGAGTCCAAGGAGG - Intergenic
1044407381 8:91844202-91844224 GGTACTTTGGGAGGTCAAGGAGG + Intergenic
1045074768 8:98552142-98552164 GGGACTCTGGGAATAGAAGGTGG - Intronic
1045361001 8:101433132-101433154 GGTGCTGTGGGACTCCAAGCTGG - Intergenic
1045805521 8:106156434-106156456 AGCACTCTGGGAGGCCAAGCTGG + Intergenic
1045949110 8:107831413-107831435 GGCACTTTGGGAGGCCAAGCCGG - Intergenic
1046100875 8:109612730-109612752 AGTACTCTGGGAGGCCAAGGCGG + Intronic
1048933274 8:139334408-139334430 GTTACTGTGGGAGCATAAGCTGG - Intergenic
1049063502 8:140294857-140294879 AGTACTCTGGGAGGCCAAGGTGG - Intronic
1049124769 8:140776934-140776956 GGTATTCTGGAAGCAAAAGCAGG + Intronic
1049521541 8:143094002-143094024 GGCACTCTGGGAGGCCAAGGTGG - Intergenic
1050734286 9:8745907-8745929 GATACTCTGGGGGTAGAGGCGGG - Intronic
1051640052 9:19216131-19216153 AGCACTCTGGGAGGCCAAGCCGG + Intergenic
1052929216 9:34042538-34042560 AGGACTCTGGGAGGCCAAGCAGG + Intronic
1054649273 9:67613083-67613105 AGTACTCTGGGAGCCCAAGGTGG + Intergenic
1055033966 9:71798234-71798256 GGCACTCTGGGAGGCCAAGGAGG - Intronic
1055161631 9:73136140-73136162 AGTACTTTGGGAGGACAAGGGGG + Intergenic
1056442871 9:86637877-86637899 GGTACACTGGGAGTCTAACCTGG + Intergenic
1056713564 9:89010529-89010551 TGTCTTCTGGGAGTACAAGGTGG - Intergenic
1058003429 9:99890590-99890612 GGTATTATGGGAGCACAGGCTGG + Intergenic
1059179894 9:112201717-112201739 AGCACTTTGGGAGTCCAAGCAGG + Intergenic
1059836847 9:118164347-118164369 GGTACTTTGGGAGGCCAAGGTGG + Intergenic
1060831498 9:126720468-126720490 AGTACTTTGGGAGTCCAAGGCGG + Intergenic
1061632919 9:131884853-131884875 AGTACTTTGGGAGTCCAAGGGGG - Intronic
1062386293 9:136312803-136312825 AGCACTTTGGGAGTACAAGGCGG + Intergenic
1185580044 X:1204772-1204794 GGTACTTTGGGAGACCAAGGCGG - Intronic
1185785237 X:2885325-2885347 GGTACTTTGGGAGGCCAAGGCGG + Intergenic
1186029658 X:5354170-5354192 GGCACTTTGGGAGGCCAAGCTGG + Intergenic
1186407204 X:9314662-9314684 GGCACTTTGGGAGTCCAAGGTGG - Intergenic
1187165812 X:16803063-16803085 GGTACTTTGGGAGGCCAAGGAGG - Intronic
1187860538 X:23678380-23678402 AGTACTTTGGGAGGCCAAGCCGG + Intronic
1188283259 X:28297143-28297165 AGTACTCTGGGAGGCCAAGGCGG - Intergenic
1188826184 X:34838115-34838137 GGAACTCTGGGAGGCCAAGGCGG - Intergenic
1189013714 X:37073749-37073771 GGTACTTTGGGAGGCCAAGGTGG + Intergenic
1189798206 X:44666416-44666438 GGTACTTTGGGAGGCCAAGCTGG + Intergenic
1190253667 X:48746707-48746729 GGTACTTTGGGAGACCAAGGCGG - Intergenic
1190522239 X:51292369-51292391 CATTCTCTGGGAGTACAAGATGG - Intergenic
1193012452 X:76692102-76692124 GGTACTCTGGAAGTAAAAGATGG - Intergenic
1193388945 X:80904649-80904671 TGTACTCTGGGAGGTCAAGGTGG + Intergenic
1194113413 X:89867127-89867149 GGTACTCTGGCTGTATAAGCAGG - Intergenic
1194946156 X:100070362-100070384 GGTACTCAGGAAGGAAAAGCTGG + Intergenic
1196743274 X:119044392-119044414 AGTACTCTGGGAGGCCAAGGTGG - Intergenic
1196797946 X:119517424-119517446 GTTACTCTGGAATAACAAGCTGG - Intergenic
1198740642 X:139838699-139838721 GGTACTTTGGGAGGCCAAGGTGG + Intronic
1199216274 X:145263322-145263344 GGTAGTCAGGGACTAGAAGCAGG - Intergenic
1199444509 X:147906438-147906460 GGTACTTTGGGAGGCCAAGGTGG - Intergenic
1199775418 X:151006700-151006722 AGTACTTTGGGAGTCCAAGGTGG - Intergenic
1199840818 X:151646155-151646177 GGCACTCTGGGAGGCCAAGGTGG - Intronic
1200466098 Y:3522186-3522208 GGTACTCTGGCTGTATAAGCAGG - Intergenic
1200773339 Y:7147534-7147556 AGTACTTTGGGAGTCCAAGGTGG - Intergenic
1201288627 Y:12400828-12400850 GGTACTTTGGGAGGCCAAGGCGG - Intergenic
1202352186 Y:24005511-24005533 AGTACTTTGGGAGGCCAAGCAGG - Intergenic
1202518593 Y:25664608-25664630 AGTACTTTGGGAGGCCAAGCAGG + Intergenic