ID: 1117304818

View in Genome Browser
Species Human (GRCh38)
Location 14:54463040-54463062
Sequence TATTACCGTTCATCTGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117304818_1117304824 22 Left 1117304818 14:54463040-54463062 CCAAAGACAGATGAACGGTAATA No data
Right 1117304824 14:54463085-54463107 AGACAGAATGATTAGAACCCAGG No data
1117304818_1117304825 30 Left 1117304818 14:54463040-54463062 CCAAAGACAGATGAACGGTAATA No data
Right 1117304825 14:54463093-54463115 TGATTAGAACCCAGGAGCCAAGG No data
1117304818_1117304819 -4 Left 1117304818 14:54463040-54463062 CCAAAGACAGATGAACGGTAATA No data
Right 1117304819 14:54463059-54463081 AATAAGTAACCACCATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117304818 Original CRISPR TATTACCGTTCATCTGTCTT TGG (reversed) Intergenic
No off target data available for this crispr