ID: 1117304822

View in Genome Browser
Species Human (GRCh38)
Location 14:54463075-54463097
Sequence AATCATTCTGTCTCTTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117304822_1117304828 6 Left 1117304822 14:54463075-54463097 CCCTAGGAAGAGACAGAATGATT No data
Right 1117304828 14:54463104-54463126 CAGGAGCCAAGGTCTCCCATAGG No data
1117304822_1117304825 -5 Left 1117304822 14:54463075-54463097 CCCTAGGAAGAGACAGAATGATT No data
Right 1117304825 14:54463093-54463115 TGATTAGAACCCAGGAGCCAAGG No data
1117304822_1117304830 13 Left 1117304822 14:54463075-54463097 CCCTAGGAAGAGACAGAATGATT No data
Right 1117304830 14:54463111-54463133 CAAGGTCTCCCATAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117304822 Original CRISPR AATCATTCTGTCTCTTCCTA GGG (reversed) Intergenic