ID: 1117304823

View in Genome Browser
Species Human (GRCh38)
Location 14:54463076-54463098
Sequence TAATCATTCTGTCTCTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117304823_1117304830 12 Left 1117304823 14:54463076-54463098 CCTAGGAAGAGACAGAATGATTA No data
Right 1117304830 14:54463111-54463133 CAAGGTCTCCCATAGGAAGCTGG No data
1117304823_1117304828 5 Left 1117304823 14:54463076-54463098 CCTAGGAAGAGACAGAATGATTA No data
Right 1117304828 14:54463104-54463126 CAGGAGCCAAGGTCTCCCATAGG No data
1117304823_1117304825 -6 Left 1117304823 14:54463076-54463098 CCTAGGAAGAGACAGAATGATTA No data
Right 1117304825 14:54463093-54463115 TGATTAGAACCCAGGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117304823 Original CRISPR TAATCATTCTGTCTCTTCCT AGG (reversed) Intergenic
No off target data available for this crispr