ID: 1117304824

View in Genome Browser
Species Human (GRCh38)
Location 14:54463085-54463107
Sequence AGACAGAATGATTAGAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117304816_1117304824 24 Left 1117304816 14:54463038-54463060 CCCCAAAGACAGATGAACGGTAA No data
Right 1117304824 14:54463085-54463107 AGACAGAATGATTAGAACCCAGG No data
1117304817_1117304824 23 Left 1117304817 14:54463039-54463061 CCCAAAGACAGATGAACGGTAAT No data
Right 1117304824 14:54463085-54463107 AGACAGAATGATTAGAACCCAGG No data
1117304820_1117304824 -6 Left 1117304820 14:54463068-54463090 CCACCATCCCTAGGAAGAGACAG No data
Right 1117304824 14:54463085-54463107 AGACAGAATGATTAGAACCCAGG No data
1117304818_1117304824 22 Left 1117304818 14:54463040-54463062 CCAAAGACAGATGAACGGTAATA No data
Right 1117304824 14:54463085-54463107 AGACAGAATGATTAGAACCCAGG No data
1117304821_1117304824 -9 Left 1117304821 14:54463071-54463093 CCATCCCTAGGAAGAGACAGAAT No data
Right 1117304824 14:54463085-54463107 AGACAGAATGATTAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117304824 Original CRISPR AGACAGAATGATTAGAACCC AGG Intergenic
No off target data available for this crispr