ID: 1117304830

View in Genome Browser
Species Human (GRCh38)
Location 14:54463111-54463133
Sequence CAAGGTCTCCCATAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117304822_1117304830 13 Left 1117304822 14:54463075-54463097 CCCTAGGAAGAGACAGAATGATT No data
Right 1117304830 14:54463111-54463133 CAAGGTCTCCCATAGGAAGCTGG No data
1117304821_1117304830 17 Left 1117304821 14:54463071-54463093 CCATCCCTAGGAAGAGACAGAAT No data
Right 1117304830 14:54463111-54463133 CAAGGTCTCCCATAGGAAGCTGG No data
1117304823_1117304830 12 Left 1117304823 14:54463076-54463098 CCTAGGAAGAGACAGAATGATTA No data
Right 1117304830 14:54463111-54463133 CAAGGTCTCCCATAGGAAGCTGG No data
1117304820_1117304830 20 Left 1117304820 14:54463068-54463090 CCACCATCCCTAGGAAGAGACAG No data
Right 1117304830 14:54463111-54463133 CAAGGTCTCCCATAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117304830 Original CRISPR CAAGGTCTCCCATAGGAAGC TGG Intergenic
No off target data available for this crispr