ID: 1117305323

View in Genome Browser
Species Human (GRCh38)
Location 14:54468365-54468387
Sequence GGGATCCTTTGAAGTCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117305323_1117305334 21 Left 1117305323 14:54468365-54468387 CCACCTAGACTTCAAAGGATCCC No data
Right 1117305334 14:54468409-54468431 AGATAATTGCCCCAGGGGTGAGG No data
1117305323_1117305325 -9 Left 1117305323 14:54468365-54468387 CCACCTAGACTTCAAAGGATCCC No data
Right 1117305325 14:54468379-54468401 AAGGATCCCAAAGAGCCTCGAGG No data
1117305323_1117305333 16 Left 1117305323 14:54468365-54468387 CCACCTAGACTTCAAAGGATCCC No data
Right 1117305333 14:54468404-54468426 CAGAAAGATAATTGCCCCAGGGG No data
1117305323_1117305332 15 Left 1117305323 14:54468365-54468387 CCACCTAGACTTCAAAGGATCCC No data
Right 1117305332 14:54468403-54468425 CCAGAAAGATAATTGCCCCAGGG No data
1117305323_1117305330 14 Left 1117305323 14:54468365-54468387 CCACCTAGACTTCAAAGGATCCC No data
Right 1117305330 14:54468402-54468424 CCCAGAAAGATAATTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117305323 Original CRISPR GGGATCCTTTGAAGTCTAGG TGG (reversed) Intergenic
No off target data available for this crispr