ID: 1117311914

View in Genome Browser
Species Human (GRCh38)
Location 14:54534408-54534430
Sequence ATTTTGTCCTCTGGGAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117311914 Original CRISPR ATTTTGTCCTCTGGGAGCAG TGG (reversed) Intronic
902084039 1:13843572-13843594 ATTTTTTCCTGTGGGATCAGTGG + Intergenic
903603522 1:24558594-24558616 ACTTTCTCCTCTGGGAGCCCAGG - Intronic
904776653 1:32912858-32912880 TTTTGGTTCTCTGAGAGCAGAGG + Intergenic
905876757 1:41436351-41436373 ATTCTGTTCTCTGGCACCAGTGG - Intergenic
906692573 1:47802269-47802291 ATCTCGCCCTCTGGGATCAGAGG + Intronic
907298802 1:53472282-53472304 ACTTTGTCCTCTGGTAACATTGG + Intergenic
907412291 1:54291284-54291306 ATTTTGTCCTGTCACAGCAGAGG - Intronic
907806238 1:57823268-57823290 ATTTTTTCAGCTGGGCGCAGTGG - Intronic
907912431 1:58838271-58838293 ATTTTCTCCTGTGGCATCAGTGG + Intergenic
908251993 1:62273076-62273098 ATTTTAGCAGCTGGGAGCAGTGG - Intronic
909980320 1:82091975-82091997 ATTTTTTCCCCTGGGAGATGGGG + Intergenic
911025467 1:93431529-93431551 ATTTTCTAGTCTGGGTGCAGTGG - Intergenic
911160148 1:94675818-94675840 AGTTTGTCATCTGGAATCAGGGG - Intergenic
911551322 1:99284566-99284588 CTTTTTTTCTCTGGGCGCAGTGG - Intronic
913251297 1:116913625-116913647 ATTGTTTCCCCTGGGGGCAGGGG + Intronic
914904642 1:151733863-151733885 ATTTTGTAGGCTGGGTGCAGTGG + Intergenic
917046410 1:170865528-170865550 ATTTTACCCTCTGGGAGTTGAGG + Intergenic
917211754 1:172638884-172638906 GTTTTGTGCTTTGAGAGCAGAGG - Intergenic
917935984 1:179867686-179867708 ATAGAGTCCTCTGGGAGGAGTGG - Intronic
919066657 1:192699823-192699845 ATTTTCTCCTTTTGGGGCAGGGG - Intergenic
919523634 1:198620608-198620630 ATTTTGTTCATTGGGATCAGTGG + Intergenic
920347379 1:205315058-205315080 AGTTTGTGCTCTGGCATCAGGGG + Intronic
921283491 1:213589010-213589032 ATTTTGGCCTCTTAGAGCAGAGG + Intergenic
921784765 1:219216894-219216916 ATATTGTACTCTGGCAGCACAGG - Intergenic
922323889 1:224510875-224510897 GCTTTGTCCTCTGGGAGAAGGGG + Intronic
922438570 1:225631089-225631111 ATTTTGTAATCTGAGAGAAGTGG - Intronic
923180875 1:231518380-231518402 ATCTTGAACTCTGGGAACAGTGG - Intergenic
923352786 1:233125920-233125942 CTTTTGTCAGCTGGGCGCAGTGG + Intronic
923740842 1:236653942-236653964 ATCTCGTCCTCTGGGTGCAGAGG + Intergenic
923858299 1:237867936-237867958 CTTTTGTCCTCAAGGAGGAGTGG - Intergenic
923928218 1:238660136-238660158 ATTTTCTCCTTTGGGAGAATTGG + Intergenic
924778650 1:247128473-247128495 ACCTTGTCTTCTGGGAGAAGAGG - Intronic
924783004 1:247169946-247169968 ACCTTGTCTTCTGGGAGAAGAGG + Intronic
1063008108 10:1994271-1994293 AGTGGGTCCTCTGGGCGCAGAGG + Intergenic
1065726808 10:28675620-28675642 GTATTGTCCTCTGGGCGCGGTGG + Intergenic
1065850187 10:29781388-29781410 TTTTTGAGCTCTGGGAGCAGTGG - Intergenic
1067425039 10:46202895-46202917 ATTTTGTATTCTGGGAGATGTGG - Intergenic
1068168576 10:53362719-53362741 ATATTGTCAGCTGGAAGCAGTGG + Intergenic
1069274365 10:66570572-66570594 ATTTTGTCGGCTGGGTGCGGTGG - Intronic
1070821537 10:79358362-79358384 GTTTTGTCATCTAGGAGGAGGGG + Intergenic
1071343627 10:84670722-84670744 ATTTTGACATCTATGAGCAGGGG + Intergenic
1071552796 10:86580138-86580160 TTTTTGTTGTCTTGGAGCAGGGG + Intergenic
1071781667 10:88852959-88852981 ATATTGGCTTCTGTGAGCAGGGG + Intergenic
1074013841 10:109512306-109512328 ATTATGTCATCTGTAAGCAGGGG + Intergenic
1074488471 10:113914453-113914475 ATTTAGTGCGCTGGGCGCAGCGG - Exonic
1074875136 10:117607705-117607727 TATTTCTCCTCTGGGAGAAGGGG + Intergenic
1075544765 10:123346688-123346710 CTTTTGTGCTGTGGCAGCAGAGG - Intergenic
1075582592 10:123633631-123633653 ATTCTGTGCTCTGTGAGCAGAGG + Intergenic
1076991958 11:280071-280093 TTCTTGTACTCTGGGCGCAGCGG - Exonic
1077624293 11:3756798-3756820 ATTTTGTCGGCTGGGCGCAGTGG + Intronic
1077828472 11:5836513-5836535 ATCATGTCCTCTGCCAGCAGGGG + Intronic
1078047388 11:7928308-7928330 ATGTTTTCTTCTGGGAGCAATGG - Exonic
1078154463 11:8787197-8787219 ATTTTCTCCTCTGAGAGGACAGG + Intronic
1080972850 11:37300210-37300232 GTTTAGTCCTCTGTGAGGAGGGG + Intergenic
1081828848 11:46088042-46088064 ATTTTTTCAGCTGGGTGCAGTGG - Intronic
1083453548 11:62762721-62762743 ATTAAGCTCTCTGGGAGCAGAGG + Intronic
1084302169 11:68258914-68258936 CTTTTATCCTCTGAGAGCATTGG - Intergenic
1085282448 11:75340147-75340169 ATTTGTTCCTCTGGCTGCAGAGG + Intronic
1085738448 11:79059401-79059423 ATTTTGCCCTGAGGGTGCAGAGG - Intronic
1086158272 11:83692764-83692786 GTTTTGTGCTCTAGGAGAAGAGG - Intronic
1086220660 11:84438736-84438758 TTTTTGTCCTCTGGTAGGACTGG - Intronic
1088616405 11:111633903-111633925 ATTTTTTCCTCTGGAATCACAGG + Intronic
1088788229 11:113201615-113201637 ATTTTGTCTTATCGGTGCAGTGG + Intronic
1088837795 11:113592911-113592933 ATTATGTCGGCCGGGAGCAGTGG - Intergenic
1089062564 11:115637781-115637803 TTTCTGCCCTCTGGGAGCTGAGG - Intergenic
1091187555 11:133659880-133659902 ATTTTGTCTTTTAGGGGCAGGGG - Intergenic
1091406949 12:214959-214981 TGTGTGTCCTCTGGAAGCAGAGG + Intergenic
1091631902 12:2168331-2168353 TTTTTGTCCTCTGGAAGATGAGG + Intronic
1092528935 12:9328308-9328330 ATGTAGGCCTCTGAGAGCAGTGG - Intergenic
1093269722 12:17045126-17045148 ATTCTGTCCTCTAATAGCAGTGG + Intergenic
1093834837 12:23816153-23816175 ATTTTGACCTCCTAGAGCAGTGG - Intronic
1095183647 12:39175922-39175944 ATTCTATCCTCTGGGAGCCTTGG - Intergenic
1097005835 12:55917127-55917149 AGTTTGTCAGCTGGGCGCAGTGG + Intronic
1098045086 12:66392219-66392241 ATATTCTCCTCATGGAGCAGAGG + Intronic
1099402889 12:82221765-82221787 AATTTGTTGGCTGGGAGCAGTGG - Intergenic
1099710893 12:86223374-86223396 TTTTTGTCCTTGGGTAGCAGTGG - Intronic
1101339987 12:103834883-103834905 ATTTTGTCCTCTTGCAACTGGGG + Intronic
1101498836 12:105282102-105282124 ATTATGTCCTCTGTGAACAAGGG - Intronic
1103029952 12:117605131-117605153 ATTTTGGCCTCTGTGAGGAATGG + Intronic
1103102414 12:118190070-118190092 ATTTTGTACCGTGGGAGCTGCGG - Intronic
1103308334 12:119985118-119985140 AACTTGTCATCTGGGCGCAGTGG + Intergenic
1103654005 12:122456053-122456075 CTTCTGTCCCCGGGGAGCAGGGG - Intergenic
1105940089 13:25140325-25140347 ATTTTGTTCTCTGAGAGCTGTGG - Intergenic
1106312698 13:28567717-28567739 TCTTTGTCCTCTGGGGGCAGAGG + Intergenic
1106753272 13:32796627-32796649 ATTTTGTCCTCTGCTGGCTGTGG - Intergenic
1107030344 13:35844958-35844980 ATTTTTTCGTCTGGGTACAGTGG + Intronic
1108318010 13:49257048-49257070 ATTCAGTCCTCTGGGAGTTGTGG + Intronic
1109300590 13:60586413-60586435 ATTTTGTGCTCTGTGAACTGAGG - Intergenic
1109460019 13:62644286-62644308 ATTGTGTCCTGGGGCAGCAGGGG + Intergenic
1110167741 13:72463736-72463758 TTGTTTTCCTCTGGGAGCAGAGG - Intergenic
1110436014 13:75479370-75479392 TTTTAGTCCAGTGGGAGCAGTGG - Intronic
1110519843 13:76462574-76462596 AATGTGTCCCCTGGGAGCTGAGG - Intergenic
1112177528 13:97041847-97041869 ATGTTATCAGCTGGGAGCAGTGG - Intergenic
1112629879 13:101149004-101149026 ATTTTGTAGGCTGGGCGCAGTGG + Intronic
1114412500 14:22514264-22514286 CTTTTGTCTCCTGGGATCAGAGG - Intergenic
1116119865 14:40708917-40708939 TTTTTTTCCTGTGGGATCAGTGG - Intergenic
1117311914 14:54534408-54534430 ATTTTGTCCTCTGGGAGCAGTGG - Intronic
1117986566 14:61391919-61391941 CTTATTGCCTCTGGGAGCAGGGG - Intronic
1117991702 14:61440156-61440178 ATTTTGTCATCTGCAAGCAAAGG + Intronic
1118928531 14:70217046-70217068 ATTTTATCTTCTGGAGGCAGGGG + Intergenic
1118969930 14:70626770-70626792 ATTATGTCATCTGTGAACAGAGG - Intergenic
1119116329 14:72025240-72025262 ATTTGGCCCTGTTGGAGCAGAGG - Intronic
1120124295 14:80722787-80722809 ATTCTGTCATCTGGTAGCAGAGG + Intronic
1120495154 14:85225769-85225791 CATTTGTCTTCTGGGCGCAGTGG + Intergenic
1122061999 14:99142275-99142297 CGTTTGTCTCCTGGGAGCAGAGG + Intergenic
1123479262 15:20616038-20616060 ACATTGTCCCCAGGGAGCAGGGG + Intergenic
1123638751 15:22384347-22384369 ACATTGTCCCCAGGGAGCAGGGG - Intergenic
1125675103 15:41497730-41497752 CTTTTGTAGGCTGGGAGCAGTGG + Intronic
1126649346 15:50906081-50906103 ATTTTGTCGTCCGGGCGCGGTGG - Intergenic
1126767384 15:52022547-52022569 ATTTTATGGGCTGGGAGCAGGGG - Intronic
1128551863 15:68602918-68602940 ATTTTGTTTTCTTGGGGCAGGGG + Intronic
1128590250 15:68889068-68889090 ATATTGCCCTCTGTGAACAGTGG + Intronic
1128687045 15:69694575-69694597 CTTTTCTTCTTTGGGAGCAGGGG + Intergenic
1129269175 15:74410506-74410528 ATTCTGTCCCCTGGAAGAAGTGG + Exonic
1131957832 15:97756743-97756765 ATGATGTCCTCTGGGAGCTGAGG - Intergenic
1133670567 16:8014968-8014990 ATATTGTCCTGTAGCAGCAGTGG + Intergenic
1135547620 16:23376620-23376642 ATTTTGTCAGCAGGGTGCAGTGG + Intronic
1138623262 16:58228876-58228898 ATTTTGTCAGCTGGGCGCGGTGG - Intergenic
1139393665 16:66622614-66622636 ATTTTCTCATCTGGGACCAGAGG - Intronic
1139470042 16:67173533-67173555 ACTTTGTGCTCTGGGTTCAGAGG + Intronic
1141997092 16:87642373-87642395 ATTTTGTCCTCTGAAAAGAGAGG + Intronic
1143921828 17:10336407-10336429 ATCTTGGCCTCTGTGGGCAGTGG + Intronic
1144857957 17:18280738-18280760 ATGTTGTCCTCGGGCAGCTGAGG - Intronic
1150430071 17:65107981-65108003 TCTTTGTCCTCTGGGAGCTGAGG - Intergenic
1151934286 17:77252622-77252644 ATTTTTTACTTTGGTAGCAGCGG + Intergenic
1152333389 17:79686247-79686269 ATTCTATCCACTGGGAGCACGGG + Intergenic
1152721345 17:81925198-81925220 TTATTAGCCTCTGGGAGCAGAGG - Intronic
1153303900 18:3615207-3615229 ATTTTGTCTGCTGGGCACAGTGG - Intronic
1155855037 18:30822761-30822783 ATTTTGTTAACAGGGAGCAGAGG + Intergenic
1158569909 18:58589405-58589427 ATTTTGTGCTTTGGGAACAAGGG + Intronic
1160283977 18:77521882-77521904 GTTTTGTCTTCTGGGTGCAAAGG - Intergenic
1160513962 18:79468331-79468353 ATTCTGTCCTCTCCGAGCTGGGG - Intronic
1161756776 19:6139714-6139736 ACTTTGTCCCCTGGGGGAAGTGG - Intronic
1161861861 19:6803850-6803872 ATTGTCTGCGCTGGGAGCAGTGG - Intronic
1162679714 19:12331686-12331708 AGGCTGTCCTCTGGGAGGAGTGG + Intronic
1163893315 19:20036021-20036043 ATTTTTTCGGCTGGGTGCAGTGG - Intronic
1164399930 19:27895474-27895496 ACTTTGTACTGTTGGAGCAGTGG + Intergenic
1165632612 19:37314401-37314423 ATTTTATCAGCTGGGTGCAGTGG - Intronic
1165730562 19:38142264-38142286 ATCTTGTCCCCAGGGGGCAGAGG + Intronic
1166392565 19:42417731-42417753 ATTTTGTAGGCTGGGTGCAGTGG + Intronic
1167589584 19:50396759-50396781 ATTTTGGAGGCTGGGAGCAGTGG - Intronic
925337839 2:3111603-3111625 ATTTTGCCCTCTGGGGGTGGGGG + Intergenic
925523953 2:4779317-4779339 ATTTTGTCGGCTGGGCGCGGTGG + Intergenic
926237810 2:11060291-11060313 TTTTTGCCCTCTGGGAGAATGGG - Intergenic
926323086 2:11762485-11762507 ATTTGTTCCTCTGGCAGCTGTGG + Intronic
927868598 2:26609035-26609057 ATTTGGGGCTCTGGGAGAAGTGG - Intronic
928659735 2:33489822-33489844 AATCTGTCAACTGGGAGCAGTGG - Intronic
928921181 2:36529683-36529705 ATTGTGTCCTCTGCATGCAGTGG + Intronic
929177979 2:39001348-39001370 ATTTTTTCAGCTGGGCGCAGTGG - Intronic
929345253 2:40874703-40874725 ATTTTGAAGTCTTGGAGCAGAGG - Intergenic
929614356 2:43296740-43296762 ATGCTGTCCTCTAGCAGCAGTGG - Intronic
929665602 2:43831735-43831757 AGTTTGCCCTCTGTGAGCGGGGG + Intronic
930541426 2:52711643-52711665 ATTCTGTCCTCAGTGTGCAGGGG + Intergenic
932125989 2:69145988-69146010 ATTTTGTGAGTTGGGAGCAGAGG + Intronic
933114359 2:78448518-78448540 ATTTTGATCTCTTTGAGCAGTGG - Intergenic
933647181 2:84822272-84822294 ATTTGGTTTTCTGGTAGCAGTGG - Intronic
933774347 2:85762869-85762891 ATTTTGTCCCCTAGGGACAGGGG - Intronic
933819395 2:86096013-86096035 ATTATGTCGGCTGGGTGCAGTGG - Intronic
935223878 2:101037166-101037188 TTTTTGTCTTCTGGGAGAAGAGG - Intronic
936678766 2:114746414-114746436 TTTTTCTGATCTGGGAGCAGAGG - Intronic
936956377 2:118026670-118026692 CATTTGTCTCCTGGGAGCAGAGG + Intergenic
937008024 2:118535779-118535801 TGGTTGTCCCCTGGGAGCAGTGG + Intergenic
937150021 2:119679938-119679960 AATTTGTCCTCTGGGAGTTATGG + Intronic
937941589 2:127290446-127290468 ATTTTGTTCTCAGAAAGCAGAGG - Intronic
937951160 2:127388699-127388721 ATTTTATCCTGTGGGAGATGAGG - Intergenic
938367730 2:130748079-130748101 AATTTATCCACTGGGCGCAGTGG - Intergenic
938603988 2:132873398-132873420 ATTTTTTCGGCTGGGCGCAGTGG - Intronic
946410009 2:219511094-219511116 AGGGTGTCCTCTGGGTGCAGGGG + Intergenic
947029160 2:225773147-225773169 TTTTTGGCGTTTGGGAGCAGGGG - Intergenic
947990772 2:234485733-234485755 ATTTTGTCCTCCAGGTGCAATGG - Intergenic
1168876294 20:1174438-1174460 GTTATGTCCTCTGGCTGCAGCGG + Intronic
1170370995 20:15648009-15648031 CTGTTGTCCTCTGGGCACAGTGG - Intronic
1171139352 20:22727831-22727853 ATTGTGCACTCTGGCAGCAGGGG + Intergenic
1172365620 20:34346869-34346891 ATTTTGTTGGCTGGGCGCAGTGG - Intergenic
1174899498 20:54483893-54483915 ATTTTGTTCTCTGGGATCCAGGG - Intronic
1175626087 20:60489372-60489394 ATTTGCTACTCTGGTAGCAGTGG - Intergenic
1175685042 20:61022766-61022788 TTGTTGTCCTCTGGAGGCAGAGG - Intergenic
1176005331 20:62859280-62859302 ATTTTGGCCTTGGGGGGCAGGGG - Intronic
1177595590 21:23237831-23237853 AAAATGTCCTCTGGGTGCAGTGG + Intergenic
1179097871 21:38331600-38331622 ATTCTGTCCTCTGAGAGCTCTGG + Intergenic
1183738004 22:39654482-39654504 ATGCAGTCCTCTGGGAGCTGGGG - Intronic
1183854407 22:40620559-40620581 ATTTTGTTGGCTGGGTGCAGTGG - Intronic
1184222553 22:43110337-43110359 ATTTCGTCCTCTTGGAGCCTCGG + Intergenic
1184980285 22:48090763-48090785 TTTCTGCCCTTTGGGAGCAGTGG - Intergenic
1185286684 22:50003587-50003609 ATTTTGTCAGTTGGGTGCAGTGG - Intronic
1185416899 22:50715501-50715523 ACTCTGCCCTCAGGGAGCAGAGG - Intergenic
949193938 3:1283240-1283262 GTTTTGTGGGCTGGGAGCAGTGG - Intronic
949255019 3:2035735-2035757 ATTTTGTCTTCTTGGAGCCAGGG + Intergenic
950421470 3:12902054-12902076 ACCTTGTCCTCTGGGAGAATGGG + Intronic
951256940 3:20460610-20460632 ATTTTTTCTGCTGGGCGCAGTGG - Intergenic
951450261 3:22829648-22829670 ATTTATTTCTGTGGGAGCAGTGG - Intergenic
952901295 3:38113401-38113423 ATATTGTTCGCTGGGTGCAGTGG + Intronic
953210245 3:40869125-40869147 ATTTTTTCCTCTGGGACCCATGG - Intergenic
953473381 3:43185242-43185264 GATTGGTCCACTGGGAGCAGCGG - Intergenic
955748474 3:62163895-62163917 ATTTTGTACCCAGGTAGCAGGGG + Intronic
959817779 3:110695384-110695406 ATTTTGACCTCTGGATCCAGAGG + Intergenic
960430779 3:117565936-117565958 CTTTTGTTCTCTGGAATCAGAGG + Intergenic
960938445 3:122917815-122917837 ATATTTTCCTCTGGGATCAATGG + Intronic
961093790 3:124137851-124137873 ATAGTGTCCTCTGAGGGCAGGGG + Intronic
961857167 3:129883689-129883711 ATTTTTTGGGCTGGGAGCAGTGG + Intronic
962119652 3:132548342-132548364 ATTTGCTCCTCTGGGGGAAGGGG + Intergenic
963643935 3:147890181-147890203 AGTTTGTCCCCTGGGAAAAGAGG + Intergenic
963751879 3:149188725-149188747 GTTTTTTCCACTGGGAGAAGTGG - Intronic
969496675 4:7530227-7530249 AGTTTGTCCTCTGGGGGCCGAGG - Intronic
970783121 4:19763283-19763305 ATTATGTCATCTGCAAGCAGGGG + Intergenic
971901368 4:32663639-32663661 TTCTTCTACTCTGGGAGCAGGGG + Intergenic
972768495 4:42173646-42173668 ATTTGGTCCTCTGGGCATAGAGG + Intergenic
974164533 4:58184806-58184828 ATTTTCTCAGCTGGAAGCAGTGG + Intergenic
974404947 4:61454237-61454259 ATTTTGTGGTCTTGGAGAAGAGG + Intronic
974503370 4:62734117-62734139 TTTTTATTCTCTGGGAACAGTGG + Intergenic
974512539 4:62863465-62863487 ATTTTGTACTATGAGAACAGAGG - Intergenic
975617017 4:76256688-76256710 ATTGTGTTTTCTGGGAACAGAGG - Intronic
975955765 4:79836243-79836265 TTTTTTTCCTCTGGGTGTAGTGG + Intergenic
977099458 4:92792029-92792051 GTTTTGTCCTCAGTGAGCCGTGG + Intronic
979598444 4:122559619-122559641 ATTTTGTAGGCTGGGATCAGTGG - Intergenic
980918705 4:139060455-139060477 ATTTTTTCCACTGCGAACAGAGG + Exonic
980981112 4:139655293-139655315 ATTTTGTCCTCAGGGGACATTGG - Intergenic
981554133 4:145974090-145974112 ATCTTGTCATCTGAAAGCAGAGG - Intergenic
983557391 4:169070598-169070620 GTTTTGGCCTCTGTGAGCATGGG - Intergenic
985033653 4:185817547-185817569 ATTGTGTCCTGTGGCAGCAGTGG + Intronic
985178345 4:187227590-187227612 ATCTGGTCCTCTTGCAGCAGTGG + Intergenic
987116631 5:14731106-14731128 ATGTCGTCCTCCGGGGGCAGCGG + Intronic
988313258 5:29589397-29589419 CTTTTGTTGGCTGGGAGCAGTGG - Intergenic
988323493 5:29731572-29731594 ATAATGACATCTGGGAGCAGTGG - Intergenic
990723273 5:58723372-58723394 ATATTCTACTCTTGGAGCAGGGG - Intronic
993997102 5:94736199-94736221 ATTTGATCTTCTGGGTGCAGTGG + Intronic
994749131 5:103716834-103716856 ATTTATTTTTCTGGGAGCAGGGG + Intergenic
994822603 5:104673060-104673082 ATCTTGTCATCTGTGAGCAAGGG - Intergenic
994845891 5:104987688-104987710 ATTTGGACCTCTGGGATCTGAGG + Intergenic
996755512 5:126930845-126930867 TTTTTGTTCTCTAAGAGCAGGGG + Intronic
996829638 5:127726566-127726588 ATTTTCTCCTGTGGGTGCTGGGG + Intergenic
997281393 5:132649531-132649553 ATTTTGGGGGCTGGGAGCAGTGG + Intergenic
997527924 5:134565434-134565456 TTTTTGTCCTCTGGGAAGAGGGG - Intronic
998109951 5:139493696-139493718 ATTTTTTAGTCTGGAAGCAGTGG + Intergenic
999258881 5:150225622-150225644 AGTCTGTCCTCTGGGGGCACTGG - Intronic
999657255 5:153822715-153822737 ATTCTTTCCTCTGACAGCAGAGG - Intergenic
999855814 5:155592616-155592638 ATTTTTTTCTCTGGGAGAATGGG - Intergenic
999970456 5:156856200-156856222 ATATTTTCTCCTGGGAGCAGTGG + Intergenic
1000353294 5:160369688-160369710 ATTTTGTGGTCAAGGAGCAGAGG + Intronic
1000472994 5:161669567-161669589 ATTTTTTCCTCTTCAAGCAGTGG - Intronic
1001571425 5:172732866-172732888 AGTAGGTCCTCAGGGAGCAGTGG - Intergenic
1001625827 5:173132372-173132394 AATTTGTCGGCTGGGCGCAGTGG - Intronic
1002930319 6:1629804-1629826 AATTTGTCATTTGGGATCAGCGG + Intronic
1003105615 6:3212957-3212979 ATTCTGGCCTGTGTGAGCAGTGG - Intergenic
1004231799 6:13840475-13840497 ATTATGTCAGCTGAGAGCAGTGG - Intergenic
1004841618 6:19592624-19592646 ATTTTTTCAGCTGGGCGCAGTGG - Intergenic
1005012304 6:21347611-21347633 ATTTTCTCGACTGGGAGCGGTGG + Intergenic
1005309005 6:24541508-24541530 ATTTAGTCAGCTGGGCGCAGTGG + Intergenic
1006624906 6:35390432-35390454 ATGTTGCCATGTGGGAGCAGGGG + Intronic
1006744261 6:36330421-36330443 ATTTTCTCCCCAGCGAGCAGAGG - Exonic
1008419627 6:51282871-51282893 AATTTGTCCATTGGGAGCTGGGG + Intergenic
1012093995 6:94934560-94934582 ATGTTGTGCTCAGGGAGCTGGGG - Intergenic
1014188082 6:118458334-118458356 ATGTTATCCTCTGAGAGCACTGG + Intergenic
1015999242 6:139026974-139026996 GTTTTGTCGGCTGGGCGCAGTGG - Intergenic
1016093806 6:140011845-140011867 ATTTTCTCCACTAGGCGCAGAGG - Intergenic
1019004730 6:168786839-168786861 ATTCTCTCCACTGGGTGCAGTGG - Intergenic
1019313348 7:373486-373508 CTTTTGTGCTCTGCGACCAGTGG + Intergenic
1019602291 7:1890776-1890798 ACTTTGTCCTTGGGGAGCTGAGG + Intronic
1020746139 7:12080148-12080170 ATCTTGTCCTCTGGCACCAGTGG - Intergenic
1022017754 7:26366672-26366694 ATGTTGTCCTCGGGGAGCTGTGG + Intronic
1022031155 7:26492820-26492842 ATCTTGACCCCTGGGAGCAGAGG - Intergenic
1022549079 7:31219970-31219992 ATTTTGTTGTCTGGGAGGATGGG - Intergenic
1023166842 7:37351324-37351346 AATTTGTCAGCTGGGCGCAGTGG + Intronic
1023469078 7:40493877-40493899 GATATGTCCTCTGAGAGCAGTGG + Intronic
1023616850 7:42028890-42028912 TCCTTGTCCTCGGGGAGCAGGGG + Intronic
1024683812 7:51722554-51722576 ATCATGTCATCTGTGAGCAGAGG + Intergenic
1024840565 7:53581840-53581862 ATTGTGTCATCTGTGAGCAGAGG - Intergenic
1024898611 7:54291520-54291542 ATTTTGTACTCAGGAAGCTGAGG + Intergenic
1026242855 7:68592142-68592164 AGTTGCTCCTCTGGGTGCAGTGG - Intergenic
1026291576 7:69011087-69011109 AGTTTGTTAGCTGGGAGCAGTGG - Intergenic
1027018775 7:74796275-74796297 ATTTTGTCAGCTGGGCACAGTGG + Exonic
1027069255 7:75149663-75149685 ATTTTGTCAGCTGGGCACAGTGG - Exonic
1027586174 7:80061607-80061629 AATTTGGCCTCTAGGAGCAGAGG - Intergenic
1027686694 7:81287238-81287260 AATTTGTCCGCTGGGTGCGGTGG - Intergenic
1027708892 7:81572133-81572155 ATTTTGTAGGCTGGGTGCAGTGG + Intergenic
1028059542 7:86293851-86293873 ATTATGTTCTCTGTGAACAGAGG - Intergenic
1028804454 7:95008621-95008643 CTGTTGTCCTCTGGTAGAAGAGG + Intronic
1029198959 7:98826205-98826227 CTTCTGTCCTGTGGGGGCAGGGG - Intergenic
1030489724 7:110216585-110216607 AGTTTGTCCTCCAGGAACAGAGG + Intergenic
1031646556 7:124232942-124232964 ATTTTGCTGTCTGGGAGGAGGGG + Intergenic
1031646971 7:124237962-124237984 ATTTTGCTGTCTGGGAGAAGGGG + Intergenic
1031647390 7:124242970-124242992 ATTTTGCTGTCTGGGAGGAGGGG + Intergenic
1032114705 7:129107013-129107035 ATTTTGTAGTCTGGGCACAGTGG - Intergenic
1032253612 7:130279359-130279381 ATTTTCTCCTCTGGAAGTCGGGG - Intronic
1032757237 7:134902609-134902631 CTTTTGTCCTCTGGTATCTGGGG - Intronic
1033134270 7:138771906-138771928 ATTTTGCCAGCTGAGAGCAGTGG - Intronic
1035168225 7:157003933-157003955 ATTTTATCCGCTGGGAGGAGGGG + Intronic
1036222333 8:6931191-6931213 ATTCTTCCCGCTGGGAGCAGGGG + Intergenic
1037116473 8:15235524-15235546 ACTTAGTGCTCTGGCAGCAGAGG - Intronic
1038163297 8:25061115-25061137 CTTTCTTCCTCTGAGAGCAGGGG + Intergenic
1038807074 8:30804106-30804128 ATTTTGTCAACTGGGCACAGTGG - Intronic
1039182369 8:34880682-34880704 ACTTTGACCCCTGGGAGCATGGG - Intergenic
1040760842 8:50841124-50841146 ATTTTTTTGGCTGGGAGCAGCGG - Intergenic
1041514917 8:58689927-58689949 ATTACATCCTCTGGGTGCAGTGG - Intergenic
1041611668 8:59857356-59857378 TTTTTTTCCTGTGGGATCAGTGG - Intergenic
1041945973 8:63443429-63443451 ATTTTGGTGTTTGGGAGCAGAGG + Intergenic
1042133294 8:65610382-65610404 ATTTTGTCAGCTGGGCACAGTGG - Intronic
1042704356 8:71650774-71650796 ATTTAGGCCTCTGGGAGTAATGG + Intergenic
1043432053 8:80204737-80204759 ATGGTGACCTCTTGGAGCAGAGG + Intronic
1043662795 8:82766300-82766322 TGTTTGCCCTATGGGAGCAGGGG + Intergenic
1044067049 8:87711420-87711442 ATTTGGACACCTGGGAGCAGAGG + Intergenic
1045659737 8:104425115-104425137 ATGTTGTCAGCTGGGTGCAGTGG - Intronic
1046046556 8:108972441-108972463 CTTTTGGCCCCTGGTAGCAGTGG + Intergenic
1048761269 8:137798242-137798264 ATAATGTCCCTTGGGAGCAGTGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049683747 8:143931021-143931043 GCTTTGTGCTCTGGGAGCAGGGG - Intronic
1049738436 8:144222335-144222357 ATGCTCTCCTCTGGCAGCAGGGG + Intronic
1050124650 9:2344169-2344191 ATCTTGTCTTCTGTGAACAGTGG + Intergenic
1051018089 9:12506108-12506130 ATTTATTCCTTTGGGATCAGTGG - Intergenic
1051181353 9:14415221-14415243 ATGGTGGCCTCTGGGAGCTGAGG - Intergenic
1051662476 9:19438936-19438958 ATTTTCTCAGCTGGGTGCAGTGG - Intronic
1053001697 9:34580292-34580314 CTTGGGTCCTCTGGGAACAGTGG + Intronic
1056084989 9:83138979-83139001 AGTTTCTGCTTTGGGAGCAGGGG + Intergenic
1056320128 9:85427946-85427968 ATTCTGGCCTCTGGCAGCTGGGG - Intergenic
1057067190 9:92066351-92066373 ATTTTGTCCACATGCAGCAGGGG + Intronic
1059813499 9:117883936-117883958 ATTTAGTCTTCTGGGACCACTGG + Intergenic
1062140755 9:134957514-134957536 TTCTTATCCTTTGGGAGCAGGGG + Intergenic
1062644798 9:137542217-137542239 ATCTTGTCCTCTCAGAGCACTGG - Intronic
1062710680 9:137973572-137973594 ATGGTGTGCTATGGGAGCAGAGG - Intronic
1185652467 X:1658329-1658351 AGTTTGTACTCCGGGAGGAGAGG + Intergenic
1185928572 X:4174540-4174562 ACTTTGTCAGCTGGGCGCAGTGG + Intergenic
1186081341 X:5936985-5937007 ATTTTATCCTATGGGATAAGAGG - Intronic
1186336132 X:8590596-8590618 TTTTTGACCTCTGGGGGCTGTGG - Intronic
1187692435 X:21883151-21883173 ATTTTGTGCTCTGAAAGCTGAGG + Exonic
1188114721 X:26229099-26229121 ATTTTTTCCATTGGGAGCAGTGG - Intergenic
1189337820 X:40181317-40181339 TTTTTTTCTCCTGGGAGCAGTGG + Intergenic
1189391256 X:40578844-40578866 TTTTTTTCCGCCGGGAGCAGTGG + Intergenic
1191156198 X:57276055-57276077 ATTAGGTCCACTGGGTGCAGAGG - Intergenic
1192144113 X:68669544-68669566 GCTTTGTGCACTGGGAGCAGGGG - Intronic
1192365819 X:70472263-70472285 ATTTTCTCGGCTGGGTGCAGTGG + Intronic
1192454717 X:71267170-71267192 ATGTTGTCAGCTGGGCGCAGTGG - Intergenic
1194274880 X:91866403-91866425 ATTTGGACCACTGGGATCAGTGG + Intronic
1195299501 X:103513347-103513369 ATTCTGTCCTCTGGAAGCTGTGG - Intronic
1195943073 X:110180976-110180998 ATTCTGTCCCCTGAGAACAGAGG + Intronic
1196416914 X:115480955-115480977 ATTTTGTCCTCTGCGTAAAGTGG + Intergenic
1197278120 X:124503648-124503670 ACTTTATTCTCTGGGAGCAAAGG - Exonic
1198431349 X:136569764-136569786 ATTTTCTCGTCTGGGTGCAGTGG - Intergenic
1199258512 X:145744583-145744605 ATAGTGTCATCTGGGAGCTGGGG - Intergenic
1199358142 X:146885291-146885313 ATTTAATCCTAGGGGAGCAGAGG - Intergenic
1200592122 Y:5087804-5087826 ATTTGGACCACTGGGATCAGTGG + Intronic
1201011465 Y:9551124-9551146 ACTTCGTCCTATGGAAGCAGAGG + Intergenic