ID: 1117313509

View in Genome Browser
Species Human (GRCh38)
Location 14:54551784-54551806
Sequence TACTCAAGTCAGCTTAAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117313506_1117313509 25 Left 1117313506 14:54551736-54551758 CCCAAGTGACAACAGTACTACAA No data
Right 1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG No data
1117313508_1117313509 -3 Left 1117313508 14:54551764-54551786 CCTGTGAAATGTAGATTCTGTAC No data
Right 1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG No data
1117313507_1117313509 24 Left 1117313507 14:54551737-54551759 CCAAGTGACAACAGTACTACAAG No data
Right 1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117313509 Original CRISPR TACTCAAGTCAGCTTAAGAA CGG Intergenic
No off target data available for this crispr