ID: 1117315431

View in Genome Browser
Species Human (GRCh38)
Location 14:54567204-54567226
Sequence CACCCCAGGCGGGCCGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117315431 Original CRISPR CACCCCAGGCGGGCCGTGAG GGG Intronic
900121447 1:1050161-1050183 CACCCCATGCCAGCCGTGTGTGG - Intronic
900191507 1:1354161-1354183 GTCCCCAGGAGGGCCGGGAGGGG + Intronic
904399804 1:30248545-30248567 CACCCCAGGCCACCTGTGAGTGG + Intergenic
906400015 1:45497785-45497807 CACCCCATCCGGGAGGTGAGGGG + Intronic
906427461 1:45725366-45725388 CACCCCATCCGGGAGGTGAGGGG + Intronic
908107345 1:60858647-60858669 GACCACAGGCTGGCAGTGAGCGG - Intergenic
911486627 1:98512725-98512747 CACCCCATCCGGGAGGTGAGGGG - Intergenic
912266128 1:108160055-108160077 CACCCCATCCGGGAGGTGAGGGG - Intronic
912790052 1:112640626-112640648 CGCCCCATCCGGGACGTGAGGGG + Intronic
916729452 1:167553346-167553368 TTCCCCAGGCGGGCTGTGGGCGG - Intronic
923014035 1:230112296-230112318 CACTCCAGGCGCACCCTGAGAGG + Intronic
923535084 1:234843121-234843143 CACCCCAGGGAGGCAGTGAAGGG + Intergenic
1062957824 10:1551960-1551982 CACCCCAGGGGGGCGGAGTGAGG + Intronic
1067439624 10:46301302-46301324 GACCCCAGGCTTGCCCTGAGGGG + Intronic
1067755147 10:48999650-48999672 CACACCAGGAAGGCGGTGAGGGG + Intergenic
1069870478 10:71529861-71529883 CACCCCAGGCTGGGTGAGAGGGG - Intronic
1069913520 10:71773590-71773612 CGCCCCCGGGGGGCCGTGTGGGG + Intronic
1070590054 10:77794980-77795002 GAGCCCTGGCGGGCAGTGAGGGG + Intronic
1071354932 10:84784538-84784560 CACCCCAGGCAGGGAGGGAGTGG - Intergenic
1075816039 10:125265475-125265497 CACCCCAGGTGGGTCCTGTGAGG + Intergenic
1076793387 10:132787849-132787871 GACCCTGGGCGGGCCGGGAGGGG + Intergenic
1076851271 10:133094511-133094533 AGCCCCAGGGAGGCCGTGAGAGG + Intronic
1077229308 11:1451454-1451476 GACACCAGGCTGGCCGGGAGAGG + Intronic
1077340977 11:2026184-2026206 CAGCACAGGTGGGCAGTGAGGGG + Intergenic
1077402552 11:2366349-2366371 CACCCCAGGCGGGCAGAGCCAGG - Intergenic
1077413767 11:2415113-2415135 GACCGCAGGAGGGCGGTGAGCGG - Exonic
1078561722 11:12378050-12378072 CGCCCCCGCCGGGCCGTGGGCGG + Intronic
1079644681 11:22848408-22848430 CACCCCAGCCTGGCCGACAGAGG + Intronic
1080860372 11:36145410-36145432 CACCCCATCCGGGAGGTGAGGGG + Intronic
1082002867 11:47403365-47403387 CATCCCAGGCCTGCCGAGAGTGG + Intergenic
1082087441 11:48061684-48061706 CACCCCAGAGGGGCCTTGAGAGG + Intronic
1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG + Intronic
1084186926 11:67478020-67478042 CACCCCATCCGGGAGGTGAGGGG - Intergenic
1089729504 11:120511628-120511650 CCCCCCCGGCCGGCCGTGCGCGG + Intergenic
1202823962 11_KI270721v1_random:81373-81395 CAGCACAGGTGGGCAGTGAGGGG + Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095439757 12:42228327-42228349 CACCCCATCCGGGAGGTGAGGGG + Intronic
1103457180 12:121076451-121076473 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1103457334 12:121076804-121076826 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1103775604 12:123364615-123364637 CACCCTCGGGGGGCCGTGCGGGG - Intronic
1103948305 12:124539063-124539085 CAGCCCAGGCTGCCCGCGAGCGG + Intronic
1104668674 12:130666042-130666064 GACCCAAGGCTGGCAGTGAGTGG + Intronic
1104735387 12:131133130-131133152 CTCCCCAGCCAGGCCATGAGAGG - Intronic
1105000576 12:132687611-132687633 CACCTCAGGCTGGCCGGGCGCGG - Exonic
1105211946 13:18262071-18262093 CTCCCCAGGAGGGCTGTCAGTGG - Intergenic
1107493203 13:40900774-40900796 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1108608658 13:52064078-52064100 CACCCCATCCGGGAGGTGAGGGG + Intronic
1111869885 13:93818461-93818483 CACCCTAGGTGGGCCGTGACTGG + Intronic
1113485399 13:110649106-110649128 CAGCCCAGCCGTGCCGTGAGAGG - Intronic
1114165386 14:20213176-20213198 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1121458066 14:94051834-94051856 AACCCCAGGTGGGCAGTAAGTGG - Intronic
1122637220 14:103135806-103135828 CAGCCCAGGGCCGCCGTGAGCGG + Exonic
1128892761 15:71345370-71345392 CACCCCGGGCTGCCTGTGAGAGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131548781 15:93338583-93338605 CTGCCCAGGCAGGCTGTGAGGGG + Intergenic
1132342899 15:101089164-101089186 CACCCCCGGCGGGCAGGCAGAGG + Intergenic
1132669071 16:1095337-1095359 CACCCCAGGCCAGCCTTGGGGGG - Intronic
1132670695 16:1101132-1101154 CAGCCCAGACGGACAGTGAGGGG + Intergenic
1132687643 16:1168941-1168963 CACCCCAGGCGGGCAGGGGGCGG - Intronic
1132923758 16:2416060-2416082 CACCCCTGGCGGGGCGTGGTGGG + Intergenic
1133770257 16:8863615-8863637 CAGCCCAGATGGGCCATGAGAGG - Intronic
1136335237 16:29606394-29606416 CACCCCAGGGGGGCAGATAGAGG + Intergenic
1139517306 16:67459604-67459626 AACCCCAGACAGGCCTTGAGAGG + Intronic
1139957029 16:70697987-70698009 CACCCCAGCCGGGACACGAGAGG + Intronic
1141616848 16:85214703-85214725 CACCCCACGCGGTCTGTGAGAGG - Intergenic
1142634279 17:1247240-1247262 CACCCCATCCGGGAGGTGAGGGG - Intergenic
1143784322 17:9245380-9245402 CACCACAGTCGGGCCCTGTGAGG + Intergenic
1145684563 17:26639125-26639147 CGCCCCATGCGGGAGGTGAGGGG + Intergenic
1146515069 17:33482775-33482797 CTTCCCAGGCAGGCCCTGAGAGG + Intronic
1151696694 17:75721590-75721612 CAGCCGAGGCTGGCCGGGAGAGG + Exonic
1151967104 17:77437184-77437206 CACCCCAGTGGGGCCCTGCGAGG + Intronic
1152390389 17:80000807-80000829 CACCCCCTGCGGGTCTTGAGTGG + Intronic
1152642012 17:81453151-81453173 CACTCCAGGGGGGCCGGGCGGGG - Intronic
1152694679 17:81738210-81738232 CCCCACAGTCGGGCCTTGAGAGG + Intergenic
1152716745 17:81903951-81903973 TGCTCCAGGCGGGCCGTGACAGG + Intronic
1157682309 18:49616603-49616625 CACCCCAGGTAGGCAGTGACTGG - Intergenic
1158459295 18:57632970-57632992 CACCCCATCCGGGAGGTGAGGGG - Intergenic
1161488356 19:4547995-4548017 CACCCCAGGCCAGCCGTGGGCGG - Intronic
1162164022 19:8739867-8739889 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1162730355 19:12715007-12715029 CAGCCCAGGCGGGCAGGCAGGGG - Intronic
1163775200 19:19213258-19213280 CACCCCAGACAGGCAGGGAGGGG + Intronic
1164238906 19:23366157-23366179 CACCCCATCCGGGAGGTGAGGGG - Intronic
1164643691 19:29843720-29843742 CAGGCCAGGCCGGCCCTGAGGGG + Intergenic
1164692822 19:30223566-30223588 CTCCCCAGGCGCGCCGTCGGCGG - Intergenic
1165062730 19:33212705-33212727 CAGCCCAGGCGGCCCGAGAATGG + Intronic
1166552626 19:43676512-43676534 CTCCCCAGGGAGGCCCTGAGTGG - Intergenic
1167748785 19:51367849-51367871 CGCCCCAGGCGGGCAGGCAGGGG - Intronic
1168192876 19:54752545-54752567 CACCACAGTCAGGCCTTGAGGGG + Exonic
1168194965 19:54767373-54767395 CACCACAGTCAGGCCTTGAGGGG + Intronic
1168205569 19:54848080-54848102 CACCACAGTCAGGCCTTGAGGGG + Intronic
1168572745 19:57483621-57483643 CACCCCATCCGGGAGGTGAGGGG + Intergenic
927862072 2:26566251-26566273 CACCCCAGGCAGACAGAGAGAGG - Intronic
931783473 2:65600545-65600567 CACCCCATCCGGGAGGTGAGGGG - Intergenic
931783595 2:65600818-65600840 CACCCCATCCGGGAGGTGAGGGG - Intergenic
937976177 2:127583349-127583371 CACCCCCGGCTGGCCCTGGGAGG - Intronic
938821906 2:134968449-134968471 CACCCCATCCGGGAGGTGAGGGG - Intronic
941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG + Intronic
947582519 2:231330469-231330491 CACCCCAGGAAGGGTGTGAGGGG + Intronic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
948551167 2:238773732-238773754 CAGGCCAGGGTGGCCGTGAGGGG + Intergenic
1171496893 20:25561975-25561997 CACCCCATCCGGGAGGTGAGAGG + Intronic
1171899795 20:30846934-30846956 CACCCCATCCGGGAGGTGAGGGG - Intergenic
1172280047 20:33701722-33701744 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1172643875 20:36457979-36458001 CGCTCCAGGCGGGGGGTGAGTGG + Intronic
1173498994 20:43538942-43538964 TGCCCCAGACGGGCCATGAGAGG + Intronic
1174218644 20:48935908-48935930 CGCCCCATGCGGGAAGTGAGGGG - Intronic
1174218698 20:48936036-48936058 CGCCCCATGCGGGAAGTGAGGGG - Intronic
1176081792 20:63277106-63277128 TGCTCCAGGCGGGCCGTGGGGGG + Intronic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176656654 21:9593699-9593721 CACCCCATCCGGGAGGTGAGGGG - Intergenic
1178497704 21:33101374-33101396 CACCCCGAGCTGGGCGTGAGGGG + Intergenic
1183836527 22:40458785-40458807 CACCTCAGGCTGGCCGGGCGTGG + Intronic
1184032905 22:41905259-41905281 CACCACGGGCTGGCCGTGAGAGG + Intronic
1184763669 22:46560687-46560709 CACCCTAGGTGTGCAGTGAGGGG + Intergenic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
954150763 3:48656010-48656032 GACCCCGGGCGGGGCGTCAGGGG + Intronic
954259611 3:49429150-49429172 CACGCCAGGCCGGCCTTGGGAGG + Exonic
954453807 3:50586169-50586191 CACCTCAGGAGGGCCCTGGGGGG - Intergenic
956683573 3:71804030-71804052 CACCCCAGCCTGGGCGTCAGGGG - Intergenic
961163634 3:124749983-124750005 CACCCCATCCGGGAGGTGAGGGG - Intergenic
961382198 3:126503111-126503133 CACTCCAGGTGTGCTGTGAGGGG - Intronic
961723134 3:128909085-128909107 CACCCCAGTCTTGCGGTGAGTGG + Exonic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
972173254 4:36374327-36374349 CACCCCAGGCTGGGCGACAGAGG - Intergenic
973675147 4:53255929-53255951 CACCCCATCCGGGAGGTGAGGGG - Intronic
975616422 4:76251850-76251872 CATCCCACGCGGGCCGCGCGGGG + Intronic
975633531 4:76423683-76423705 CACCCCATCCGGGAGGTGAGGGG + Intergenic
986687710 5:10288875-10288897 CTCCCCAGGCTGGCTGAGAGGGG - Intronic
987358641 5:17086750-17086772 AACCTCAGGTGGGCCGGGAGTGG + Intronic
991907091 5:71525224-71525246 CACCCCATCCGGGAGGTGAGGGG - Intronic
992269964 5:75053658-75053680 CACCCCGGGCCGGGCGAGAGCGG - Intergenic
992610034 5:78499680-78499702 AACCACAGGAGTGCCGTGAGGGG + Intronic
998382717 5:141737198-141737220 GACCCCAAGGGGGCAGTGAGAGG + Intergenic
998779594 5:145641663-145641685 CCCCCCAGGGGGGCCCTGACAGG + Intronic
999153832 5:149443977-149443999 GTCCCAAGGCGGGCTGTGAGAGG + Intergenic
999462925 5:151772221-151772243 CGCCCCAGCCGGGACGGGAGCGG - Intronic
1000014638 5:157266289-157266311 CGCCCCCCGCGGGCCGGGAGAGG - Intronic
1000922974 5:167160358-167160380 CACAGCAGGCGGGGCATGAGTGG - Intergenic
1001599667 5:172920670-172920692 CACCCCTGCCGGGCCGTGCGAGG - Intronic
1002527179 5:179821228-179821250 GACGCCTGGCGGGCCGTGAGGGG + Intronic
1003308536 6:4949242-4949264 CACCCCAGCAGGCCCCTGAGAGG - Intronic
1005159068 6:22837284-22837306 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1005644302 6:27826730-27826752 CGCCCCATCCGGGCCGTGAGGGG - Intergenic
1006281711 6:33059540-33059562 CACCCCATCCGGGAAGTGAGGGG - Intergenic
1006281785 6:33059715-33059737 CACCCCATCCGGGAAGTGAGGGG - Intergenic
1007301601 6:40871926-40871948 CACCCCATGCAGGCCCTGTGGGG + Intergenic
1018009862 6:159660457-159660479 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1020022940 7:4879848-4879870 CAGCTCTGGCGGGCAGTGAGAGG - Intronic
1020066157 7:5190144-5190166 AAGCCCAGGCAGGCGGTGAGAGG + Intergenic
1020281757 7:6653487-6653509 CCCCCCAGGGGCGCCGGGAGCGG - Exonic
1022094449 7:27130226-27130248 CACCCCAGGCGTCCCGGCAGGGG - Exonic
1022505574 7:30907122-30907144 TACCCCAGGCTGGCCGTGCCTGG - Intergenic
1024625926 7:51208466-51208488 CACCCCATCCGGGAGGTGAGGGG + Intronic
1027182734 7:75952051-75952073 CACCCCATCCGGGAGGTGAGGGG - Intronic
1031468627 7:122143991-122144013 GACCCCGGCCGGGCCGAGAGAGG - Intronic
1035473922 7:159129068-159129090 CCCCCCAGGCGGGTGGTGACGGG - Intronic
1040977268 8:53207748-53207770 CACCACAGCTGGGCCCTGAGGGG - Intergenic
1048018903 8:130520332-130520354 CACCCCAGGCATGCAGAGAGGGG - Intergenic
1049807705 8:144548366-144548388 GACCCCAGGTGGGCCGTCTGGGG + Exonic
1051365487 9:16318810-16318832 CCTCACAGGGGGGCCGTGAGTGG - Intergenic
1053267531 9:36726079-36726101 CATCCCAGTCTGGCAGTGAGTGG - Intergenic
1054343727 9:63893603-63893625 GAGCCCAGGCAGGCCGTGAAGGG + Intergenic
1055242149 9:74197776-74197798 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1059461027 9:114430183-114430205 CAGGCCAGGAGGGCAGTGAGGGG + Intronic
1060736253 9:126068239-126068261 CACTCCAGGCTGGGCGAGAGAGG - Intergenic
1061389924 9:130311794-130311816 CTCCCCAGGCGGGGAGTGACTGG - Intronic
1062265213 9:135683760-135683782 CACCCCAGGCCAGCCCTGAGGGG + Intergenic
1062324184 9:136004538-136004560 CCCACCAGGCGGCCCGTGAGGGG - Intergenic
1062448330 9:136604994-136605016 GCCCCCAGGCGGGCGGTGGGAGG - Intergenic
1062555756 9:137112791-137112813 CACTCCAGGTGGGCTGTGATCGG - Exonic
1062587697 9:137256793-137256815 CACCACAGGCTGCCTGTGAGTGG - Intronic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203405811 Un_KI270539v1:881-903 CGCCCCATGCGGGAGGTGAGGGG + Intergenic
1203634367 Un_KI270750v1:97183-97205 CACCCCATCCGGGAGGTGAGGGG - Intergenic
1185648883 X:1634347-1634369 CTCTCCAGGCTGGCAGTGAGTGG - Intronic
1185651377 X:1650356-1650378 CACCCCAGGCCATCCGTGAAAGG - Intergenic
1187184262 X:16968784-16968806 CACCCCATCCGGGAGGTGAGGGG - Intronic
1190304934 X:49076539-49076561 CAACACAGGATGGCCGTGAGGGG + Intronic
1192663959 X:73069180-73069202 CACCCCATCCGGGAGGTGAGGGG + Intergenic
1192663996 X:73069291-73069313 CACCCCACCCGGGAGGTGAGGGG + Intergenic
1194718509 X:97313670-97313692 CACTCCAGCCGGGGCGAGAGAGG - Intronic
1201766689 Y:17579535-17579557 CACCCCAGGCGCGCGGCGATGGG - Intergenic
1201834863 Y:18326449-18326471 CACCCCAGGCGCGCGGCGATGGG + Intergenic
1201863734 Y:18626892-18626914 CACCCATGGCGAGCCATGAGTGG - Intergenic
1201869588 Y:18693486-18693508 CACCCATGGCGAGCCATGAGTGG + Intergenic