ID: 1117327816

View in Genome Browser
Species Human (GRCh38)
Location 14:54684960-54684982
Sequence GAGGGTGGCCAGGAAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 1, 2: 5, 3: 77, 4: 661}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117327807_1117327816 29 Left 1117327807 14:54684908-54684930 CCATTCAGTTCTGGGTACCAGGT 0: 1
1: 0
2: 1
3: 5
4: 155
Right 1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG 0: 1
1: 1
2: 5
3: 77
4: 661
1117327809_1117327816 12 Left 1117327809 14:54684925-54684947 CCAGGTTTTCAAAGAGGCATTAA 0: 1
1: 0
2: 0
3: 18
4: 193
Right 1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG 0: 1
1: 1
2: 5
3: 77
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117327816 Original CRISPR GAGGGTGGCCAGGAAGCTGC AGG Intronic
900352318 1:2241072-2241094 GAGGGAGCCCAGGATGCTGTGGG + Intronic
900739986 1:4325068-4325090 GGAGGTGGCCAGGGAGATGCTGG + Intergenic
900798446 1:4723493-4723515 GGAGGTGGCCAGGAGGCTGCAGG + Intronic
900852880 1:5157706-5157728 GACTGTGGCCAGGAAGCAGGTGG + Intergenic
900917380 1:5648261-5648283 AAGGGTGGCCATGAAGGTCCTGG + Intergenic
900958332 1:5902307-5902329 GAGGTTGGCCAGACAGCAGCAGG - Intronic
901229040 1:7631782-7631804 GAGGGTAGCCAGGAGGCAGGGGG - Intronic
901234634 1:7661351-7661373 GAGAGTGGACAGGAGGCTGAGGG - Intronic
902515974 1:16989855-16989877 CAGGGCGGCCAGGGAGCTGGGGG + Intronic
902810149 1:18883461-18883483 GAGGATGGACAGGAGGCTGTTGG - Intronic
903017191 1:20368855-20368877 GAGGGTGGATAGGAGGCTGGAGG + Intergenic
903294612 1:22335799-22335821 AAGGCTGGCCAGGAAGGAGCAGG - Intergenic
903322414 1:22551046-22551068 GATGGTGGCCTGGCAGCTGTGGG - Intergenic
903660009 1:24971302-24971324 GTGGGAGGGCAGGAATCTGCTGG - Intergenic
904418594 1:30377413-30377435 GAGGGCCTCCAGGAACCTGCTGG - Intergenic
904537175 1:31207575-31207597 CAGGGGGGTCAGGCAGCTGCTGG - Intronic
904601336 1:31674216-31674238 GAGGGTGGCCAGGATGAGGGGGG + Intronic
904615378 1:31746686-31746708 GAGGCTGGGCAAGAAGCTGGGGG - Intronic
904830532 1:33303703-33303725 GAGGGGTTCCAGGAAGCTGCAGG - Intergenic
905239080 1:36570943-36570965 GACTGTGGCCTGGAGGCTGCAGG + Intergenic
905303175 1:36999278-36999300 GAGGTGGGAGAGGAAGCTGCAGG + Intronic
905515545 1:38559342-38559364 GGAGTTAGCCAGGAAGCTGCGGG + Intergenic
905874575 1:41423819-41423841 GAGGGTGGCCTGGGAGGGGCAGG - Intergenic
906678695 1:47710575-47710597 GAGCGAAGCCTGGAAGCTGCGGG + Intergenic
906720557 1:48001238-48001260 GAGGGTGGGTAGGAAGGAGCAGG - Intergenic
907487356 1:54787095-54787117 GAGGGTCTCTAGGAAGCAGCAGG + Intronic
908124244 1:61014425-61014447 GAGGGGGTCCTGAAAGCTGCAGG - Intronic
908892181 1:68860401-68860423 GAGAGGGGCCAGGAAAGTGCTGG - Intergenic
910951612 1:92654002-92654024 GGGGGTGGCAGGGAAGCTCCTGG - Intronic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
913247029 1:116879080-116879102 GAGGGAGGGCAGGCAGCTGCTGG - Intergenic
913632720 1:120724694-120724716 GAGGCTGGCTGCGAAGCTGCAGG - Intergenic
914981333 1:152416921-152416943 GAAGTTGGACAGGCAGCTGCTGG - Intergenic
915321153 1:155057160-155057182 GAGGGTGGCAAGGAAGGTTGGGG - Intronic
915526948 1:156481725-156481747 GAGGGTGCCCGGGAAGCCACAGG - Intronic
915826770 1:159086430-159086452 GAGGGAGGCCAGGAAGGGCCTGG - Intronic
915931047 1:160061264-160061286 GATGGTGTCCAGGCAGCTGGTGG - Intronic
916123677 1:161550650-161550672 GGGGGTGGCCAGGAAGTGGGAGG + Intronic
916133564 1:161632013-161632035 GGGGGTGGCCAGGAAGTGGGAGG + Intronic
917977665 1:180250766-180250788 GAGGGTGGAGAGGAAGGTGATGG + Intronic
918203194 1:182286458-182286480 GAAGGTGGTCAGGAGGCTACAGG + Intergenic
918241994 1:182628872-182628894 GAGGGAGGCCAGGGTGCTGTTGG - Intergenic
919077607 1:192831777-192831799 GAAGGTCGGCAGGAAGCTTCTGG + Intergenic
919964252 1:202505503-202505525 GAGAGTGGACAGAAAGTTGCTGG - Intronic
919983617 1:202657941-202657963 GAGGGTCCCCAGGAAGGGGCTGG - Intronic
920102408 1:203525641-203525663 CAGGAGGCCCAGGAAGCTGCTGG + Intergenic
920547002 1:206826569-206826591 GAGGGTGGACTGGAGGCTGCTGG - Intronic
920598640 1:207299555-207299577 GAGCATGGGCAGCAAGCTGCAGG - Intergenic
920685374 1:208105157-208105179 GAGGGTGGCCAGGATGGGGTGGG + Intronic
920826112 1:209425575-209425597 GTGTGTTCCCAGGAAGCTGCTGG - Intergenic
920915575 1:210255447-210255469 GTGGGTGGCCACGAATCTGCAGG + Intergenic
921046123 1:211479165-211479187 GAAGGTGGCCAGGCTGCCGCGGG + Exonic
921692167 1:218164613-218164635 GAGGGCGGACTGGAAGCAGCGGG - Intergenic
922757398 1:228104089-228104111 GAGGGTGTCTGGGTAGCTGCTGG - Intronic
922938652 1:229440981-229441003 GAGGTTGGACAGGGAGTTGCTGG - Intergenic
1062792366 10:316617-316639 GAGGGTAGCCAGGGCTCTGCTGG + Intronic
1062876449 10:946761-946783 GAGGGTGGCAAGGAAGAGGAGGG - Intergenic
1062923518 10:1297612-1297634 GAGGAGGGCAAGGGAGCTGCTGG - Intronic
1063088409 10:2839930-2839952 CAGGCTGGGCAGGAAGCTGGGGG - Intergenic
1063141806 10:3262497-3262519 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1064096040 10:12425164-12425186 GAGGGTGCCCAGGAGCCAGCTGG - Intronic
1064290067 10:14025696-14025718 GATGATGGCCAGGCAGCTGTGGG - Intronic
1065722056 10:28636619-28636641 GACAGTGCCCATGAAGCTGCAGG + Intergenic
1067317467 10:45181531-45181553 GAGGCTGGCCAAGAGCCTGCGGG + Intergenic
1067432949 10:46255904-46255926 TAGGTTGGCCAGGCAGTTGCTGG - Intergenic
1067473139 10:46550225-46550247 CAGGGTGGCCAGGCCCCTGCAGG - Exonic
1068887174 10:62109591-62109613 GAATGTGGCCATGAGGCTGCAGG + Intergenic
1069067238 10:63955375-63955397 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
1069076026 10:64039306-64039328 GAGGAGGGCCAGCAAGGTGCAGG - Intergenic
1070333084 10:75431705-75431727 CATGGCGGCCAGGACGCTGCGGG - Intronic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1070778627 10:79124874-79124896 GAGTTTGGCCATGAACCTGCAGG + Intronic
1070806992 10:79276504-79276526 GAGGGTGGCCAGGGTGGTGGGGG - Intronic
1070976494 10:80609690-80609712 GTGGGAGTCCAGGAGGCTGCAGG + Intronic
1071178687 10:82957664-82957686 AAGGGTGGACAGGAAGTTGCTGG - Intronic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1072154842 10:92715016-92715038 GAGGGTGGCCAGGAGCAGGCAGG - Intergenic
1072193722 10:93097091-93097113 CAGGGGCGCCTGGAAGCTGCAGG + Intergenic
1072421253 10:95291818-95291840 GAGCCTGGCTAGGAAGCTGGTGG - Intergenic
1072595610 10:96868862-96868884 GTGGGTGTCCAGTAAGTTGCTGG + Intronic
1072636843 10:97183851-97183873 GAGGGTGACCAGGCCACTGCGGG + Intronic
1073073308 10:100808337-100808359 TAGGGGGGCCAGGAAGCGGAAGG + Intronic
1073137219 10:101226760-101226782 GAGGGAGGCGAGGAAGGAGCGGG + Exonic
1073328303 10:102655241-102655263 GCAGGAGGCCAAGAAGCTGCTGG + Exonic
1074009384 10:109461173-109461195 GAGAGTAGCGTGGAAGCTGCTGG - Intergenic
1074057300 10:109934047-109934069 CAGGGTGAGCAGGAAGCTGTGGG + Intergenic
1074185729 10:111098217-111098239 GAGTGTGGGCAGGAGGCTGCAGG - Intergenic
1074373116 10:112916632-112916654 AAGAGTGCCCAGGAACCTGCAGG - Intergenic
1074764171 10:116688262-116688284 GATGAGGGCCAGGAAACTGCAGG - Intronic
1075058557 10:119238260-119238282 GAGGGTGGACGGGAAGCGGGGGG + Intronic
1076050221 10:127327449-127327471 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1076564212 10:131387029-131387051 GAGGAAGCCCAGGGAGCTGCAGG - Intergenic
1076625791 10:131820967-131820989 GAGGCTGGCCTTGAAGATGCAGG + Intergenic
1076749307 10:132534486-132534508 GAGGCTGGACAGGCAGCTACTGG - Intergenic
1076855925 10:133115625-133115647 GAGGGAGGCCAGGACCCCGCCGG + Intronic
1077555428 11:3223792-3223814 GAGGGTGCGCAGGACCCTGCTGG - Intergenic
1077897366 11:6463591-6463613 CAGGGAGGCCAGGACGCAGCTGG + Intronic
1078055194 11:8003557-8003579 TAGGGTGGGCAGGCAGCTGGGGG - Intergenic
1078447355 11:11414384-11414406 GAGGGTGGTAAGGAAGCGGGAGG - Intronic
1078551819 11:12286305-12286327 GATTGAAGCCAGGAAGCTGCAGG - Intronic
1080185825 11:29484434-29484456 GAGTCTGGCAAGGAAGCTTCAGG + Intergenic
1080966885 11:37224070-37224092 GTGGCTGGGCAGGAAGCTCCAGG + Intergenic
1081176680 11:39935704-39935726 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1081592505 11:44434400-44434422 GAGTGTGTTCAGGAAGCAGCTGG - Intergenic
1081747539 11:45483569-45483591 GGGGGTGGGAATGAAGCTGCCGG + Intergenic
1082009653 11:47441616-47441638 CTGGGTGGCCAGGAAGGCGCTGG - Exonic
1082683452 11:56208512-56208534 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1083148647 11:60776350-60776372 GAGGGTTTCCAGGAAGCAGGGGG - Exonic
1083302136 11:61744919-61744941 GGGGGTGGCCAGGACGATGCCGG - Exonic
1083307014 11:61766493-61766515 GAGAGTGGACAGGAAGCGGCGGG + Intronic
1083402870 11:62436138-62436160 CAGGGTGGGGAGGAAGTTGCAGG + Intronic
1083554378 11:63614227-63614249 GCGGGCGCCCAGGAGGCTGCAGG + Exonic
1083625497 11:64069982-64070004 GCAGGGGGCCAGGAAGCTGGGGG + Intronic
1083683440 11:64361765-64361787 GAGGGCGGCCAGAGGGCTGCAGG + Intronic
1083962303 11:66021170-66021192 GACGCTGGTCAGGAAGCTGTGGG + Exonic
1084038692 11:66529387-66529409 GAGGGTGCTCACTAAGCTGCTGG + Intronic
1084319441 11:68365310-68365332 GAGGGTGGCCAGGAAGGTCACGG + Intronic
1084495303 11:69500009-69500031 GAGGTTGGCCAGGAAGGGGCAGG - Intergenic
1084738925 11:71125534-71125556 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1084762388 11:71282410-71282432 GAGGGTGGCCTGGAAGAGGTGGG - Intergenic
1084946214 11:72640031-72640053 GAGGATGGCCAGTGAGCTGGCGG - Intronic
1085426394 11:76408601-76408623 GAGCAGGGCCAGGAAGGTGCTGG + Intronic
1086959650 11:92969414-92969436 GAGGTGGGCCAGGCACCTGCTGG + Intergenic
1087239301 11:95757399-95757421 GTGGATGGACAAGAAGCTGCTGG - Intergenic
1089169190 11:116500491-116500513 GAAGGTGGCCGGGAGGCTGTGGG - Intergenic
1089596500 11:119584338-119584360 GAGGTTGGGCCGGAAGCTGAGGG - Intergenic
1090498103 11:127234288-127234310 GGGGCTGGGTAGGAAGCTGCTGG + Intergenic
1091297375 11:134483334-134483356 GGGGGTGGTCAGGAGGCTTCTGG + Intergenic
1091392082 12:131766-131788 GAGGGTGGGGAGGAAGGTGTAGG + Intronic
1091668009 12:2433105-2433127 AAGGGTGTCCAGGCTGCTGCTGG + Intronic
1091979110 12:4851213-4851235 GAGGATGCCCAGCAAGCTGCAGG - Intronic
1092171487 12:6376236-6376258 GGGGGTGGCGAGGAATCAGCAGG - Intronic
1092355906 12:7794967-7794989 GAGGCTGCCTTGGAAGCTGCTGG + Exonic
1092368463 12:7896720-7896742 GAGGCTGCCTTGGAAGCTGCTGG - Intergenic
1092368739 12:7898775-7898797 GAGGCTGCCTTGGAAGCTGCTGG + Intergenic
1092478976 12:8843231-8843253 GTGGATGCCAAGGAAGCTGCGGG - Exonic
1093402073 12:18758493-18758515 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1094533928 12:31304424-31304446 GTGGGAGGCCAGGAATGTGCAGG + Intronic
1094679769 12:32657910-32657932 GGGGCTGGCCGGGGAGCTGCCGG - Intergenic
1094799728 12:34019179-34019201 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1095112517 12:38313498-38313520 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1095159938 12:38904963-38904985 GTGGGTGGGGAGGAAGCTGCCGG + Intronic
1095992928 12:48050393-48050415 GAGGATGCCTAGGCAGCTGCGGG + Intronic
1096196429 12:49651773-49651795 GAGGGAGGCCTGGAATCTGAGGG - Intronic
1096440373 12:51637629-51637651 GAGGGAGGTGAGGAAGCTGCAGG + Intronic
1096572545 12:52532032-52532054 GAGCTGGGTCAGGAAGCTGCCGG - Intergenic
1096968084 12:55644484-55644506 GTGGTTGGCTAGGATGCTGCAGG - Intergenic
1099310360 12:81012851-81012873 GAGGTTGGACAGGCAGTTGCTGG - Intronic
1099795101 12:87390310-87390332 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1101373240 12:104149246-104149268 AAGGTTGGACAGGCAGCTGCTGG - Intergenic
1101819173 12:108169961-108169983 CAGGGTGGCCAAGAAGCTGAAGG + Intronic
1102147592 12:110666614-110666636 GAGTGTGGCGAGGAGGCTGTGGG - Intronic
1102433057 12:112898552-112898574 GATGGCAGCCAGGAAGCTGTTGG - Exonic
1103076702 12:117989059-117989081 GATGGTGGCCAGGAACGGGCAGG + Intergenic
1104073908 12:125372821-125372843 GTGTGTGGCCAGAACGCTGCGGG - Intronic
1104969781 12:132525986-132526008 AAGGGCGTCCAGGAAGCCGCTGG + Intronic
1105812663 13:24008742-24008764 GGGGGTGGACAGGGAGCTGGGGG - Intronic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1108515365 13:51196844-51196866 GAGACTCCCCAGGAAGCTGCTGG + Intergenic
1109549438 13:63874263-63874285 AAGGCTGGGCAGGAAGTTGCTGG - Intergenic
1110512238 13:76364466-76364488 GAGGTTGGACAGGCAGCTGTTGG + Intergenic
1110777606 13:79427534-79427556 GAGATTGGACAGGCAGCTGCTGG - Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1112848408 13:103672727-103672749 GAGTGTGGGCAGGAAGCAGCAGG - Intergenic
1116013927 14:39383848-39383870 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1116016501 14:39414270-39414292 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1117063933 14:51989810-51989832 GAGAGGGGCCCGGAGGCTGCCGG - Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117820030 14:59638683-59638705 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1118919816 14:70139698-70139720 GAGTTTGGCCAGACAGCTGCTGG + Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1120590151 14:86364842-86364864 GTGGGAGGACAGGAAGCTCCAGG - Intergenic
1120833167 14:89016121-89016143 GAGGGTGACTAGGAAGATGGAGG + Intergenic
1121148122 14:91604508-91604530 GAGGCTGCCTTGGAAGCTGCTGG - Intronic
1121554736 14:94827916-94827938 GAACGGGGCCAGGTAGCTGCCGG + Intergenic
1121780205 14:96617453-96617475 GAAGGTGTCCAGGAAGATTCTGG + Intergenic
1121814755 14:96920683-96920705 GAGGGTGGCCTGGGAGCTGCTGG - Intronic
1122849964 14:104522789-104522811 GAGGGAGGCCAGCACACTGCAGG - Intronic
1123054224 14:105561641-105561663 GAGCGTGGCCAGGCAGCCCCAGG + Intergenic
1123078808 14:105682060-105682082 GAGCGTGGCCAGGCAGCCCCAGG + Intergenic
1123506284 15:20942944-20942966 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1123760115 15:23425334-23425356 CAGGGTGGCCGGAAACCTGCTGG + Intergenic
1124047560 15:26164141-26164163 GTGGGTGGCAAGGAAGGTGGTGG + Intergenic
1124214712 15:27796895-27796917 GAGGGTTGCCAGAGAGCTCCAGG - Intronic
1124372367 15:29110977-29110999 CCGAGTGGCCAGGAAGCTGAGGG + Intronic
1124983302 15:34583409-34583431 GGGGGCGGCGCGGAAGCTGCAGG - Intronic
1125032206 15:35084299-35084321 GAGGCTGCCTTGGAAGCTGCTGG - Intergenic
1126800192 15:52291258-52291280 GAAGGTGGCCTGGATGCTGAGGG + Intronic
1126849919 15:52790517-52790539 CTGGATGGCCAGGGAGCTGCGGG + Intronic
1127417632 15:58772189-58772211 GAGGATGGCCAGCAAGGGGCAGG - Exonic
1127847649 15:62885436-62885458 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1127934694 15:63625794-63625816 GAGGTTGGACATGATGCTGCTGG - Intronic
1128683685 15:69668664-69668686 GAGGGTGGGCAGGAGCCAGCTGG - Intergenic
1129238223 15:74236495-74236517 GAGGGTGGCCAGGTGGGAGCAGG - Exonic
1129344261 15:74906697-74906719 GAGGGTGGCCCCGCAGCTCCCGG + Exonic
1129476246 15:75786177-75786199 GAAGGTGGGCAGGAAGGAGCAGG + Intergenic
1129803980 15:78438639-78438661 GACGGGGGCCAGGAAGCCGCTGG - Intronic
1130958957 15:88647164-88647186 CATGGTGGCCAGGAGGCTCCGGG + Intronic
1131047700 15:89326613-89326635 CAGGGTGTCCAGGAAGGTGCTGG + Exonic
1131056783 15:89379506-89379528 GAGAGTGGCCAGGGAGCCGTGGG + Intergenic
1131232095 15:90666802-90666824 GAGGGTGGCCAGGCAGCTCCTGG + Intergenic
1132116001 15:99137031-99137053 GACTGTGGCCATGAGGCTGCAGG - Exonic
1202971868 15_KI270727v1_random:243785-243807 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1132584922 16:701946-701968 GAGCCTGGCCTGGGAGCTGCTGG + Intronic
1132678485 16:1130370-1130392 GAGGCTGCCCAGGAGGCTGGGGG + Intergenic
1132720427 16:1312977-1312999 GAGGGTGGCATTGAGGCTGCTGG + Intronic
1132807254 16:1780531-1780553 CAGGGAGGCCAGGAACCTGAAGG - Intronic
1132865638 16:2091486-2091508 GAGGGCGGCCAGGGCGCGGCCGG + Exonic
1132953522 16:2578411-2578433 GAGGATGTCCAGGGAGCTGACGG + Intronic
1132960830 16:2621756-2621778 GAGGATGTCCAGGGAGCTGACGG - Intergenic
1133002312 16:2857572-2857594 CAGGCTGGACGGGAAGCTGCGGG - Intronic
1133018513 16:2955747-2955769 GAGGGTGGCCAGGACTCTGAGGG + Intergenic
1134216171 16:12318491-12318513 GAGGATGGGAATGAAGCTGCCGG - Intronic
1134233237 16:12445693-12445715 GAGGTTGGAGAGGAAGCTGATGG - Intronic
1134456224 16:14397542-14397564 CAGGGTGGCCAGAAACCTGCTGG - Intergenic
1135663898 16:24319373-24319395 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1135755009 16:25089926-25089948 GTGGCTGGCCATGAAGCTGGAGG + Intergenic
1136083433 16:27867823-27867845 GGGCGTGGCCAGGAAGTGGCTGG - Intronic
1136398731 16:30006549-30006571 GAGGGAGGCCAGGGAGGGGCTGG - Intronic
1137735783 16:50722118-50722140 GAGGATGGCCCAGAAGCTGGGGG + Intronic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1138439748 16:57026883-57026905 CAGGGTGGCCAGGTCGGTGCAGG - Exonic
1138562904 16:57812627-57812649 GAGGGTGGCAAGAAAACGGCTGG + Intronic
1138590814 16:57998797-57998819 AAGGGTTGGCAGGAAGCTGGAGG - Intronic
1138718699 16:59053462-59053484 GAGAGCCCCCAGGAAGCTGCTGG - Intergenic
1139295501 16:65897030-65897052 GTGGGTGCCCCGGAAGCTGTGGG - Intergenic
1139354867 16:66361413-66361435 GGAGGTGGCCTGGGAGCTGCCGG - Intergenic
1139549264 16:67664458-67664480 GAGTGTGTCCAGGAAGCAGATGG - Intronic
1139593679 16:67946561-67946583 GGTGGTGGCCAGCAAGGTGCGGG - Exonic
1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG + Exonic
1140364150 16:74368362-74368384 GAGGGTGGCAAAGAGGCCGCGGG - Intergenic
1140433013 16:74920933-74920955 GATGGTGACCAGGTAGCTTCGGG + Intronic
1141440281 16:84025630-84025652 GAGGGAGGCCTGGTGGCTGCTGG - Intronic
1141935861 16:87237243-87237265 GGGGCTGGCCAGGCAGGTGCTGG + Intronic
1141992452 16:87618318-87618340 GAGGGAGGCCGGGCAGCAGCTGG + Intronic
1142124534 16:88403595-88403617 GAGGGTGGCAGAGCAGCTGCTGG + Intergenic
1142181711 16:88674449-88674471 AAGGATGGACAGGAGGCTGCAGG - Intergenic
1142231932 16:88904014-88904036 GAGGGTGGCCAGGAGACCGCTGG + Intronic
1142359286 16:89619110-89619132 CAGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359314 16:89619171-89619193 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359355 16:89619262-89619284 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359383 16:89619322-89619344 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142469569 17:155862-155884 GGGGGTAGCCAGGAGGCTGGGGG - Intronic
1142582354 17:949879-949901 GAAGGTGCCCAGGCAGATGCTGG - Intronic
1142953076 17:3500129-3500151 GAGAGAGGTGAGGAAGCTGCAGG + Exonic
1142974571 17:3635999-3636021 AAGGGTGGTCAGGAGGCTCCTGG + Intronic
1143148146 17:4789752-4789774 GAGGGGAGTCAGGAACCTGCGGG - Exonic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143407286 17:6685917-6685939 GAGGGAGGCCAGGTAGCCGAGGG - Exonic
1143504457 17:7356101-7356123 GAGGAGGGCCTGGCAGCTGCAGG + Intronic
1144038919 17:11391216-11391238 GAGGGTGGGCAGGAAGGTGATGG + Intronic
1144203165 17:12959646-12959668 GAGCGTGTTCAGCAAGCTGCAGG + Intronic
1144431544 17:15196774-15196796 GAGGTTGGACAGAGAGCTGCTGG - Intergenic
1144698467 17:17321579-17321601 GAGAGCTGCCAGGCAGCTGCAGG + Intronic
1144835660 17:18155383-18155405 AAGGGTGGCCAGGAGGCCGGCGG + Exonic
1145902872 17:28499354-28499376 GAGGGTGGACAGGCAGCAGGTGG + Intronic
1145941531 17:28745536-28745558 GAGGGGGGCCAAGAAGGTGGTGG - Intronic
1147182307 17:38694045-38694067 AGAGATGGCCAGGAAGCTGCTGG + Intergenic
1147220406 17:38925503-38925525 GTGGGGGGGCAGGAAGCTGCTGG + Intergenic
1147260778 17:39208854-39208876 AAGGGTGCCTAGGAAGCTACTGG - Intergenic
1147768900 17:42854533-42854555 GCAGGTGACCCGGAAGCTGCTGG + Exonic
1147771704 17:42872490-42872512 GCAGGTGACCCGGAAGCTGCTGG + Intergenic
1147844718 17:43396918-43396940 GAGGGTGGGCAGGAAAAGGCTGG + Intergenic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1148456332 17:47813406-47813428 GTGGGGGGCAAGGAAGGTGCAGG + Intronic
1148852630 17:50562138-50562160 GGCGGTGGGGAGGAAGCTGCGGG + Intronic
1148945560 17:51259739-51259761 GAGCGGGGTCAGGGAGCTGCGGG + Intronic
1149601815 17:57898322-57898344 GGGTCTGGCCAGGAAGCTGCCGG + Intronic
1150337658 17:64342313-64342335 GAGTGGGGCCAGCAAGCTGGAGG - Intronic
1150437795 17:65167616-65167638 GATGGTGACAAGGAAGATGCTGG - Intronic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151475703 17:74343368-74343390 GAGCTTGGCCTTGAAGCTGCAGG - Intronic
1151483310 17:74383206-74383228 CAGGGAGGCCAGGGAGCAGCTGG + Intergenic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1151703321 17:75754484-75754506 GTGGGTGACCAGGAATGTGCAGG + Intronic
1152022298 17:77786555-77786577 GAAGGTGGCCAAGAAGTTGTGGG + Intergenic
1152122306 17:78426347-78426369 GAGCATGGCCAGGAGGCTCCTGG - Intronic
1152565468 17:81098291-81098313 GAGAGTGGCGAAGAAGCTGAGGG - Intronic
1152651915 17:81498907-81498929 GAGGCTGGTGAGGAAGCTCCAGG - Intergenic
1152698641 17:81808300-81808322 GAGGATGGTGAGGAAGCAGCCGG + Intronic
1152710426 17:81868403-81868425 GGGGCTGGCCAGGGAGCAGCGGG + Exonic
1153133137 18:1880966-1880988 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
1154322668 18:13367612-13367634 GAGGGTGGGCAAGCAGCTGCAGG + Intronic
1154341690 18:13508187-13508209 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1156523788 18:37746885-37746907 GATGGTGGCCAAGCAGCTGGAGG + Intergenic
1157145155 18:45155133-45155155 AAGGGTGGCCAGCAATCTTCTGG - Intergenic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1157404573 18:47412250-47412272 GAGGGTGGGCATGAGGCTGGGGG - Intergenic
1157499322 18:48178929-48178951 AAGGGTGGCCATGGAGCAGCAGG + Intronic
1157622287 18:49023608-49023630 CAGGGTGGGCAGGAAGCAGGTGG - Intergenic
1158358685 18:56648368-56648390 GAGGGTGACCAGAAACCTGGAGG - Intronic
1158808834 18:61007490-61007512 GAGGGAGACCATGAAGCTGGAGG - Intergenic
1159276757 18:66232051-66232073 GAGAGTCCCCAGGAGGCTGCTGG - Intergenic
1160126434 18:76176876-76176898 GGGATTGGACAGGAAGCTGCTGG + Intergenic
1160156198 18:76435813-76435835 GACCGAGGTCAGGAAGCTGCAGG - Intronic
1160431963 18:78818986-78819008 GAGACTGGCCAGGGAGATGCAGG + Intergenic
1160793945 19:935240-935262 GTGGGTGGCCAGGCCGCGGCGGG + Intronic
1160828295 19:1090830-1090852 GTGGGTGGCCAGGAAGATGTGGG - Intronic
1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG + Intronic
1160875454 19:1294491-1294513 GAGGGAGACCAGGAGGCCGCCGG + Intronic
1161285974 19:3468479-3468501 CTGGGTGGGCAGGAAGCTGGGGG - Intronic
1162463797 19:10829306-10829328 CAGGGAGGGCAGGAACCTGCAGG - Intronic
1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG + Intronic
1162819546 19:13214250-13214272 GAGCAAGGCCAAGAAGCTGCAGG - Exonic
1163105822 19:15122623-15122645 GGGTGTGGGCTGGAAGCTGCAGG + Intronic
1163242311 19:16071802-16071824 GGGAGTGGGCAGGAAGCGGCCGG - Intronic
1163352731 19:16788644-16788666 GTGGCTGGACAGGAAGTTGCTGG + Intronic
1163368539 19:16889372-16889394 GGGGGAGGCCGGGAAGTTGCGGG + Intronic
1163418360 19:17200614-17200636 GAGGGGGGACAGGAAGCAGCCGG - Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163819277 19:19486998-19487020 AAGGGTGGCCAGTGAGCTCCAGG + Intronic
1164236918 19:23345629-23345651 GAGGGTGGACAGCAGTCTGCTGG - Intronic
1164656354 19:29924788-29924810 GAGCCTGGACAGGAAGCTGAGGG - Intronic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1165363125 19:35349021-35349043 GCAGGTGGCCAGGAAGCTAGGGG + Intergenic
1165444179 19:35847996-35848018 GGGGGTGGCCAGGAATGTGGGGG - Intronic
1166015127 19:39973968-39973990 GGAGGTGTCCAGGAGGCTGCTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166688675 19:44810339-44810361 GAGGGGGGCCAAGAGGCGGCTGG + Intronic
1166698862 19:44870302-44870324 GAGGGCGGCCAGGAGGATGTGGG + Intronic
1166750527 19:45162188-45162210 CACAGTGGCCAGGAGGCTGCTGG + Intronic
1166863433 19:45822590-45822612 GAGGGTGGCCTGGGAGCTCCGGG + Intronic
1166887861 19:45972850-45972872 GAGGGAGGCTGGGAAGCTCCCGG + Intronic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167226867 19:48250324-48250346 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1167238687 19:48330494-48330516 GAGGGGGGCCGGGAAGGGGCGGG - Exonic
1167356153 19:49005526-49005548 TAGGATGGCCAGGAGGCTCCTGG + Intronic
1168180514 19:54659717-54659739 GAGGGTGGTGAAGAAGCTGAAGG - Intronic
1168316460 19:55486746-55486768 GGGCGTGGGCAGGAGGCTGCTGG + Exonic
1168695490 19:58401633-58401655 GATGGGGGACAGGAGGCTGCGGG + Intronic
1202649149 1_KI270706v1_random:165142-165164 GATTGTGGCAAGGATGCTGCTGG + Intergenic
925174720 2:1774486-1774508 GAGGTTGGCCAGGTAGTTGGTGG + Intergenic
925254144 2:2467915-2467937 GAGGCTGGCCTAGAACCTGCCGG - Intergenic
925326077 2:3023091-3023113 GAGTGAGGACAGGAAGCTGTTGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
925422789 2:3725766-3725788 GAGGGTGGCCAGGTGGATCCCGG + Intronic
925429607 2:3779798-3779820 GGTGGCAGCCAGGAAGCTGCAGG - Intronic
925440740 2:3883214-3883236 GAGAGCCCCCAGGAAGCTGCTGG + Intergenic
925566986 2:5266670-5266692 GAGGATGCCCATGTAGCTGCTGG + Intergenic
926155095 2:10448950-10448972 GGGGGTCGCCAGCACGCTGCGGG + Intergenic
926973744 2:18492629-18492651 GAAGGAGTCCAGGGAGCTGCTGG - Intergenic
927578711 2:24222479-24222501 GAGGTTGGACAGGCAGTTGCTGG - Intronic
928549597 2:32357615-32357637 AAGGGAGGCCCGGAAGCTGATGG + Intronic
928818475 2:35329126-35329148 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
929117635 2:38457615-38457637 AAGGGGCTCCAGGAAGCTGCAGG - Intergenic
930817166 2:55610067-55610089 GAGTCTGGCCAGGAAGGTGATGG - Intronic
930831377 2:55747251-55747273 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
930858468 2:56044323-56044345 GAGGGTTCCCAGTAAGCTCCTGG + Intergenic
931201756 2:60104413-60104435 GAAGATGGTCAGGAAGCTGCTGG - Intergenic
931387566 2:61810919-61810941 GAGGTAGGCCAGGAGGATGCAGG + Intergenic
932297446 2:70638721-70638743 GAGGGGGGACAGGAAGCAGACGG + Intronic
932380412 2:71276814-71276836 GTGGGTGGGCAGGAAGGGGCGGG + Intronic
932412353 2:71554879-71554901 GAGGCTGGGCGGGAAGCTGATGG + Intronic
933651945 2:84856689-84856711 GGGGGTGTCCAGGAGGCAGCGGG - Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933941445 2:87248371-87248393 GCAGGTGGCCAAGCAGCTGCAGG - Intergenic
935202102 2:100866080-100866102 GTGTGTGGCCAGACAGCTGCAGG - Intronic
935802105 2:106708059-106708081 TAGGTTGGACAGGAAGCTGCTGG + Intergenic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936338779 2:111613220-111613242 GCAGGTGGCCAAGCAGCTGCAGG + Intergenic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
936473609 2:112820537-112820559 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
936531642 2:113280106-113280128 GAGGGGGGCAAGGAAGGTGCAGG + Intergenic
936974763 2:118207901-118207923 GAGTGTGGCCAAGAAGGTGGAGG - Intergenic
937228195 2:120381835-120381857 AAGGGTGACCAGGGAGCAGCCGG + Intergenic
937275229 2:120679748-120679770 TAGGGTGGCTGAGAAGCTGCAGG + Intergenic
937339904 2:121084507-121084529 AATGGTGGAGAGGAAGCTGCTGG + Intergenic
937737940 2:125313996-125314018 GAGGTGGGACAGGCAGCTGCAGG - Intergenic
938163784 2:129009145-129009167 GAGGATGCCCAGGAAGGTGCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941929963 2:170929415-170929437 GACGGCGGCCGGGGAGCTGCGGG + Intronic
942245449 2:174003824-174003846 GATGGTGGCCAGAAACCTGCAGG + Intergenic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
943878258 2:193102240-193102262 GAGGCTGGGCAGGCAGGTGCTGG + Intergenic
944414772 2:199470273-199470295 GAGGATCCCCAGGAAGATGCTGG + Intronic
945287875 2:208100258-208100280 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
946180712 2:217947289-217947311 GAGGGAGGGCAGGAGGCTGAAGG + Intronic
946448712 2:219761728-219761750 GAGGATGGCCAGGGAGCAGGTGG - Intergenic
946651420 2:221895888-221895910 TAGGAGGGCCAGGAAGCGGCGGG - Intergenic
947335748 2:229080941-229080963 GAGGCTGGACAGGAAGGTACTGG - Intronic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
947718534 2:232353694-232353716 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
947730008 2:232422625-232422647 GAGGATGGACAGGCAGGTGCTGG - Intergenic
948338992 2:237233930-237233952 AAGGGAAGCCAGGAAGGTGCAGG + Intergenic
948456154 2:238105578-238105600 GAGGATGGACAGGAGGCGGCCGG + Intronic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
948715015 2:239855573-239855595 AAGGGTGGACAGGCAGTTGCTGG - Intergenic
948725381 2:239930813-239930835 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948725413 2:239930899-239930921 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948754681 2:240151936-240151958 GATTGTGTCCAGGAAGCTCCTGG + Intergenic
948785469 2:240350169-240350191 AAGGGTGGCCAGGATGGGGCAGG + Intergenic
948903048 2:240965758-240965780 CAGTGTCACCAGGAAGCTGCAGG + Intronic
948932678 2:241142085-241142107 GAGAGTGCCCAGGATACTGCAGG - Intronic
948955088 2:241283224-241283246 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
948961694 2:241343991-241344013 GAGGGCGGCAATGAAGCTGCTGG - Intronic
1169325870 20:4676035-4676057 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1169404875 20:5314912-5314934 CAGGAGGGCCAGGATGCTGCGGG + Intergenic
1169506827 20:6220344-6220366 GTGGATGGCCAAGAAGCTGCTGG + Intergenic
1170547727 20:17449311-17449333 GAGGGTGGCCCTGGAGCTGAAGG - Intronic
1170608897 20:17895485-17895507 GGGGGTGGGCAGGGAGCTTCTGG - Intergenic
1170611166 20:17914895-17914917 GAGAGGGGCCAGGGAGCTGAAGG + Intergenic
1170682761 20:18541164-18541186 GAGAGAGGTAAGGAAGCTGCAGG - Intronic
1170770137 20:19325557-19325579 GAAGGTGGTCAGGAAGGAGCAGG - Intronic
1171188580 20:23141843-23141865 GATGGTGGGCAGGAGGCTGGAGG - Intergenic
1171298770 20:24041376-24041398 GGGGGTAGCCAGGAGGCTGGAGG - Intergenic
1171320281 20:24237138-24237160 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1171970172 20:31559566-31559588 GAGAGTGGCAGGGAAGCAGCAGG - Intronic
1172040382 20:32040563-32040585 GGGGGTGGCCATGCAGCTGGGGG + Intergenic
1172444558 20:34986249-34986271 GATGGGGGCCAGGAAGCGCCAGG - Intronic
1172834223 20:37862690-37862712 GAGGGTGGGCAGAAAGCAGTGGG - Intronic
1172889328 20:38252895-38252917 GGGGGTGCCCAGGCGGCTGCAGG + Intronic
1173594050 20:44247541-44247563 GCCGGTGGCCAGGAAGCTTGGGG + Intronic
1174174279 20:48635273-48635295 GGTGGTGGCCAGGAAGCTGGAGG - Intronic
1174446114 20:50592487-50592509 CAAGGTGGTCCGGAAGCTGCAGG - Exonic
1174567845 20:51479860-51479882 GAGGGTGGCAGGGAAGCGGGTGG - Intronic
1175079697 20:56408831-56408853 GAGTGGGGACAGGAAGCTGGAGG - Intergenic
1175619805 20:60433924-60433946 GAGGTTGGACAGGAAGTTGCTGG + Intergenic
1175702394 20:61149332-61149354 CAGGATGGGCAGGCAGCTGCCGG + Intergenic
1175820066 20:61904317-61904339 GGGGGTCACCAGGCAGCTGCTGG + Intronic
1175860907 20:62149519-62149541 GATGGGGGCCATGGAGCTGCAGG + Intronic
1176602669 21:8807400-8807422 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1177046150 21:16172742-16172764 GAGAGAGGCGAGGAAGCTGCAGG - Intergenic
1177724628 21:24951057-24951079 AAGGGCCCCCAGGAAGCTGCTGG + Intergenic
1178410492 21:32359825-32359847 GAAGGTGGCCCTGGAGCTGCCGG - Exonic
1178735465 21:35145553-35145575 GATGGTGGCCAGGACCCTGCAGG - Intronic
1178844949 21:36166850-36166872 GCTCGTGGCCAGTAAGCTGCTGG + Intronic
1179220019 21:39398362-39398384 GAGCGTGCCCAGGGAACTGCTGG + Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179783988 21:43719465-43719487 GAGGGAGGCTCGGGAGCTGCGGG + Intronic
1179947191 21:44686425-44686447 GGGGGTGGCCAGGTGGCAGCAGG - Intronic
1180190092 21:46158813-46158835 GAGGGTGGCCCTGAAGTGGCTGG - Intergenic
1180344954 22:11698957-11698979 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1180352781 22:11817904-11817926 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1181107318 22:20582860-20582882 GGGGCTGGGCAGGAAGCTACTGG - Exonic
1181185237 22:21098623-21098645 GAGGGCCACCAGGAAGATGCTGG + Intergenic
1181349521 22:22245070-22245092 GAGGGTGGCCCGGCCTCTGCTGG - Exonic
1181627875 22:24133691-24133713 GTGGCTGGCCAGGCAGCTGGTGG + Intronic
1181805945 22:25374539-25374561 GAGGGTGGCCAGGAAGGTCACGG - Intronic
1181853959 22:25769220-25769242 GAGGCTGGCCAGGAAGCCGTGGG + Exonic
1181941758 22:26483469-26483491 GAAAAGGGCCAGGAAGCTGCTGG + Intronic
1182074240 22:27484037-27484059 GAGGGGGTCCAGGAAGGAGCAGG - Intergenic
1182586470 22:31346628-31346650 GAGGGGGGGCAGGAAGCGGGGGG - Intergenic
1182634758 22:31716881-31716903 TATGGTGGCCATGAAGCTGTTGG + Exonic
1182662165 22:31932961-31932983 GAGGGAGACCAGGAAGGGGCGGG + Intergenic
1183168582 22:36166727-36166749 GGTGGTGGCCACGAGGCTGCAGG - Intergenic
1183710686 22:39501741-39501763 GAGGGAGGCGAGGAAGGGGCTGG + Intronic
1183749336 22:39710892-39710914 AAGGCTGGACAGGCAGCTGCTGG - Intergenic
1183756309 22:39769522-39769544 CAGGGTAGCCTGGAAGTTGCAGG - Intronic
1184018265 22:41801988-41802010 GAGGTTGGACAGGCAGTTGCAGG + Intronic
1184094458 22:42309095-42309117 GAGGCTGGCCTGGAAGGGGCAGG + Intronic
1184168385 22:42743846-42743868 GAGGGAAGCCAGGAAGTGGCGGG + Intergenic
1184388362 22:44188922-44188944 GAGGGTCTCCTGGAAGCTGGAGG + Intronic
1184453436 22:44596258-44596280 GAGGGTGCCTGGGAAGCTTCTGG + Intergenic
1184692270 22:46122782-46122804 GATGGTGGCCAGGCCGGTGCTGG - Intergenic
1184694255 22:46131009-46131031 CAGTGTGGACAGGAAGCTGGTGG + Intergenic
1184723452 22:46329304-46329326 GATGGTTGCCAGAAAGATGCTGG + Intronic
1184754214 22:46507335-46507357 GGGGGTAGCCAGGGAGCTACTGG + Intronic
1184915824 22:47568338-47568360 AAGGTTGGACAGGCAGCTGCTGG - Intergenic
1185100419 22:48837716-48837738 GAGTGTGGCCAGGACGCGGTGGG - Intronic
1185318946 22:50191387-50191409 GTGGGTGGCCAGGACCCAGCTGG + Intronic
949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG + Intronic
950458421 3:13106255-13106277 GTGGGAGCCCAGGAAGGTGCTGG - Intergenic
950790679 3:15469305-15469327 GAAGGAAGCCAGGAAGCTTCTGG + Intronic
950930273 3:16782306-16782328 GAGGGAGGCCAGGAAGAAGGAGG + Intergenic
951913760 3:27777919-27777941 GGGGGTGGTCAGGAAGCAGAAGG + Intergenic
952282710 3:31938916-31938938 GAGGGTGGGCAGGAAGTTGAAGG - Intronic
952455897 3:33471569-33471591 GAGGCTGGACAGGCAGGTGCTGG + Intergenic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
952839338 3:37630938-37630960 GAGGCAGGGCAGGAAGCTGATGG + Intronic
953752021 3:45616270-45616292 GAGGTTTGTCAGGAAGATGCTGG - Intronic
953901306 3:46845686-46845708 CAGGGTGTCCCGGGAGCTGCGGG + Intergenic
954202624 3:49033137-49033159 GAGGGTGGTCAGCAAGGTGGAGG + Exonic
954237735 3:49269793-49269815 GAGGTTGGCCTGGCACCTGCTGG - Exonic
954238736 3:49277071-49277093 GGGGCGGGCCAGGAAGCTGTGGG - Exonic
956163105 3:66375187-66375209 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
957318277 3:78595656-78595678 GTGGGTGGTCAGGAAGCAGGCGG - Intergenic
958464709 3:94443242-94443264 GGGGGTGGCAAGGCAGCTGGGGG - Intergenic
960401560 3:117205780-117205802 GAGAGCGGTGAGGAAGCTGCAGG + Intergenic
961378404 3:126481991-126482013 GCAGGTGGCCAGGAAGCAGAGGG + Exonic
961400807 3:126641036-126641058 GAGGCTGGACAGGCAGTTGCTGG - Intronic
961503101 3:127351179-127351201 GAGGGTGGAGAGGAGGCAGCTGG - Intergenic
961577989 3:127854136-127854158 GATGGTGACCTGGAGGCTGCAGG + Intergenic
961772098 3:129257589-129257611 CCGGGTGGCCAGCAAGCAGCTGG + Exonic
963102709 3:141622010-141622032 GAGGGAGGTGGGGAAGCTGCTGG + Intergenic
963291776 3:143497551-143497573 GATGCTGGCCAGGAAGCTGCTGG + Intronic
963538559 3:146559061-146559083 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
963604786 3:147405050-147405072 GAGGGGAGCCAGAAAGGTGCAGG - Intronic
963949392 3:151182484-151182506 AAGGGTGGCCAGGGAGCCTCTGG + Intronic
964290024 3:155168015-155168037 GTGGTTGGCAAGGAAGCTGTAGG + Intronic
966685765 3:182692852-182692874 GAGGTTGAACAGGAAGTTGCTGG + Intergenic
967073274 3:185980641-185980663 GAGCGGGGGCAGGAAGCTGGAGG + Intergenic
967298055 3:187984918-187984940 TAGGGTGGCCGGGAAACTGGTGG - Intergenic
967390201 3:188947800-188947822 GGGGGTGGGGAGGAGGCTGCAGG - Intronic
967562754 3:190935539-190935561 GAGGATGGAAAGGAAGCTACAGG - Intergenic
968230865 3:197003736-197003758 GATTTTGGCCAGGAGGCTGCGGG - Intronic
968502626 4:958123-958145 GATGCTGGCCAGGAAGATGATGG - Exonic
968661718 4:1801392-1801414 GCGGATGGACAAGAAGCTGCTGG + Exonic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
968830308 4:2930237-2930259 CAGGGTGTCCAGGGAACTGCTGG + Intergenic
969057711 4:4412517-4412539 TAGGAAGGCCAGGGAGCTGCTGG + Intronic
969058100 4:4414454-4414476 TAGGAAGGCCAGGGAGCTGCTGG + Intronic
969367896 4:6710002-6710024 GAGGGGCGCCGGGAAGCAGCTGG - Intergenic
969592542 4:8130225-8130247 CAGGGTGGCCAGGGTGGTGCTGG + Intronic
969607591 4:8210252-8210274 AAGGGGGCCCAGGAAGCTGCTGG + Intronic
969624286 4:8294492-8294514 CAGGGAGTCCAGGAAGCTGATGG - Intronic
969659541 4:8518425-8518447 AAGGGAGGGCGGGAAGCTGCTGG + Intergenic
969709984 4:8837190-8837212 GAGGCTGGACTGGAAGATGCTGG + Intergenic
969860738 4:10033723-10033745 CAGGTCGGCCAGGCAGCTGCAGG - Intronic
970797004 4:19924638-19924660 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
972532790 4:39976730-39976752 GCGGGTGGCGAGGCCGCTGCCGG - Intronic
973375318 4:49282285-49282307 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973376219 4:49288298-49288320 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973377139 4:49294453-49294475 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973378058 4:49300589-49300611 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973379006 4:49306887-49306909 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973380087 4:49314763-49314785 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973381003 4:49320918-49320940 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973382093 4:49327956-49327978 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973385623 4:49512571-49512593 GATTGTGGCAAGGATGCTGCTGG + Intergenic
974115886 4:57578714-57578736 GAGGGCCCCCTGGAAGCTGCTGG - Intergenic
975683249 4:76896904-76896926 GTGGGTGGCCAGGCACCCGCAGG - Exonic
976129586 4:81870569-81870591 GGGGGTGCCCAGGAAGCCCCTGG + Intronic
976207913 4:82639802-82639824 GAGGAAGGAGAGGAAGCTGCTGG - Intronic
976665692 4:87588437-87588459 CAGGGTGGCCTCGAAGCTGCAGG + Intergenic
977762225 4:100752533-100752555 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
977764388 4:100779444-100779466 AAGGTTGGACAGGAAGTTGCTGG - Intronic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
978379440 4:108111601-108111623 GAGGGAGGCAAGAAAGGTGCTGG + Intronic
978558650 4:110008209-110008231 GAGGATGGCCAGGCAGCAGATGG + Exonic
978591989 4:110333996-110334018 GAGGCTGGACAGGAAGGTGGAGG + Intergenic
978620999 4:110634115-110634137 GAGGCGGGGCAGGGAGCTGCGGG + Intronic
980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG + Intergenic
981509858 4:145544181-145544203 GAGGGAGGCTAGGAAGGTGTGGG + Intronic
982036358 4:151349814-151349836 GAGAGAGGTAAGGAAGCTGCAGG + Intergenic
983798766 4:171901171-171901193 GAGGGTGGGCAGGGATTTGCTGG - Intronic
983865475 4:172760617-172760639 GGAGGTGGCTAGGAAGTTGCAGG - Intronic
985663160 5:1167409-1167431 AGGGCTGGCCAGGAAGCTGGAGG - Intergenic
985783194 5:1881445-1881467 GAGGGAGGCCAGGAGCCTGAAGG + Intronic
985812864 5:2103119-2103141 GAGGGTGGCCAGGCAGCAGGAGG + Intergenic
985967400 5:3348119-3348141 GAGGGGGCACAGGAAGCTGGAGG - Intergenic
986131080 5:4930956-4930978 AAGGTTGGACAGGCAGCTGCTGG + Intergenic
986341385 5:6792211-6792233 GAGGTTGGACAGGCAGCTGCTGG + Intergenic
986848106 5:11779490-11779512 GAGGGTGCCCAGCAAGGTGCTGG + Intronic
987029493 5:13962900-13962922 GAGGCTGGCCGAGCAGCTGCCGG - Intergenic
987033752 5:13999368-13999390 GGTGGTGGCCAGGAGGCTGGGGG - Intergenic
987154052 5:15070077-15070099 AAGGCTGGACAGGAAGTTGCTGG + Intergenic
988599210 5:32623893-32623915 TGAGGTGGCCAGGGAGCTGCAGG + Intergenic
989828968 5:45890954-45890976 GAGGATGGCCAGGCAGGGGCTGG - Intergenic
992362907 5:76060537-76060559 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
992701988 5:79350091-79350113 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
992748329 5:79840066-79840088 GAGGTTGGGGAGGAAGGTGCTGG - Intergenic
994760951 5:103853345-103853367 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
995797033 5:115952276-115952298 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
996903053 5:128565885-128565907 AAGGAAGGCCAGGAAGCTGGAGG - Intronic
997117397 5:131139808-131139830 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
997196109 5:131981041-131981063 CTGGGAGGCCAGGAAGATGCGGG - Intronic
997207807 5:132060244-132060266 GTGGGTGGCCAGGAGGCCACTGG - Intergenic
997742483 5:136269265-136269287 AATAGTGGCCAGGAAGCTTCGGG - Intronic
998352021 5:141508120-141508142 GAGGGAGGTCAGGGAGCTGGGGG + Intronic
998452383 5:142244943-142244965 GAGAATGGGCAGGAAGCTCCAGG + Intergenic
998950430 5:147388372-147388394 GTGGGCAGCCAGCAAGCTGCTGG + Intergenic
1000253812 5:159519444-159519466 CAGTTTGGCCAGGATGCTGCAGG + Intergenic
1001034561 5:168288384-168288406 GAGGGTGGCCAGGAGAGGGCTGG + Intergenic
1001106446 5:168858610-168858632 GAGGGAGCTCAGAAAGCTGCTGG - Intronic
1001310260 5:170605175-170605197 GAGGGTGGGCAGGTGGCTGGTGG - Intronic
1001450757 5:171822660-171822682 GAGGGAGGGCAGGCAGATGCAGG - Intergenic
1001534879 5:172491306-172491328 GTGGGTGGCCAGTAGGCAGCCGG - Intergenic
1001970852 5:175953904-175953926 AAGGGTGGGTAGGAATCTGCTGG - Intronic
1002197296 5:177508439-177508461 GATGGTGGCCTGGGAGCAGCGGG - Exonic
1002246586 5:177889860-177889882 AAGGGTGGGTAGGAATCTGCTGG + Intergenic
1002449044 5:179308769-179308791 CAGAGGGGCCAGGAACCTGCAGG - Intronic
1002648508 5:180674153-180674175 CAGGGTGGCGAGGAACCGGCAGG + Intergenic
1002661361 5:180792856-180792878 GAGGGTGGCCTGCCAGGTGCTGG + Exonic
1003154379 6:3578761-3578783 GAGGGTGGACATGCTGCTGCCGG + Intergenic
1003184169 6:3816139-3816161 GCAGGTGGACAGGAAGCAGCTGG + Intergenic
1003856845 6:10285019-10285041 GAAGGAGACCAGGGAGCTGCTGG + Intergenic
1003896070 6:10608945-10608967 CAGGGTGGCCAGAGAGCTCCTGG + Intronic
1004004572 6:11627153-11627175 GATGCTGGCCAGTGAGCTGCAGG - Intergenic
1004231467 6:13837539-13837561 GAGGTTGGACAGGTAGTTGCTGG - Intergenic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1004779600 6:18893923-18893945 GATTGTAGCTAGGAAGCTGCGGG + Intergenic
1006181737 6:32157667-32157689 GATCAGGGCCAGGAAGCTGCTGG - Exonic
1006865148 6:37203382-37203404 GAGGCTGGAGAGGAAGATGCCGG + Intergenic
1007020640 6:38517434-38517456 GAAGGTGGCCAGGCAGCGGGTGG - Intronic
1007398434 6:41590173-41590195 GAGGGTGGGCTGGGGGCTGCAGG + Intronic
1007769834 6:44183774-44183796 AAGGGTGGGAAGGAATCTGCAGG + Intronic
1007834659 6:44665289-44665311 GAGGGTGGCCAGGCAGCCCCCGG - Intergenic
1008516256 6:52322094-52322116 GAGGGAGGTGAGGAAGCTTCAGG - Intergenic
1010055463 6:71558915-71558937 CAGGTTGGTCAGGAAGCTGAGGG + Intergenic
1012352175 6:98265941-98265963 GAGGGTGGCTTGGGAGCAGCTGG + Intergenic
1012413174 6:98983436-98983458 GAGGGTGCCCAGGCAGGGGCAGG + Intergenic
1014849383 6:126322711-126322733 GAGGTTGGACAGGCAGATGCTGG - Intergenic
1014850487 6:126334747-126334769 GAGGTTGGACAGGCAGATGCTGG - Intergenic
1015204824 6:130624364-130624386 GAGGTTGGACAGGTAGTTGCTGG - Intergenic
1016461174 6:144281549-144281571 GGTGGGGCCCAGGAAGCTGCAGG - Intergenic
1016961558 6:149677602-149677624 GAAGATAGCCAGGAAGCAGCTGG + Intronic
1017780790 6:157713740-157713762 GAAGGTGGGCAGGCAGCTGACGG + Intronic
1017955992 6:159178170-159178192 GAGGATGGACAGGAAGTTGCTGG - Intronic
1018176484 6:161182707-161182729 GAGGGTGGGCAGCCAGCGGCTGG + Intronic
1018202675 6:161410187-161410209 GTGGGTGGCCAGGAATCTGAAGG + Intronic
1018219608 6:161565171-161565193 GAGGGAGGCTAAGAAGCTGAGGG - Intronic
1018462098 6:164008057-164008079 GAGGCTGGCCAGGAATGTGCAGG - Intergenic
1018537415 6:164836243-164836265 GAGGTTGGACAGGAGGTTGCTGG - Intergenic
1018808223 6:167277558-167277580 GAGAGTGGACGGGCAGCTGCTGG + Intronic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019523113 7:1469339-1469361 GAGGGTGGGCAGGCGGGTGCAGG + Intergenic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020106387 7:5424056-5424078 GAGGGGAGCCTGGAAACTGCTGG - Intronic
1021338472 7:19433724-19433746 GAGAGCTCCCAGGAAGCTGCTGG - Intergenic
1021869262 7:24987451-24987473 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1022312821 7:29213088-29213110 GAGGCTGCCTTGGAAGCTGCAGG + Intronic
1023861827 7:44221308-44221330 GAGTGGGGCCGGGAAGCTGCAGG - Intronic
1024470223 7:49761789-49761811 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1024603270 7:51005457-51005479 TAGGGTGTCAAGAAAGCTGCTGG - Intergenic
1025078735 7:55964677-55964699 GAGCCTGGGCAGGAGGCTGCAGG - Exonic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1027916765 7:84334641-84334663 GGGGGTGACCAGGAGGCAGCAGG - Intronic
1029328163 7:99827708-99827730 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1029350459 7:100009723-100009745 GAAGGTGGCCAGGGAGGGGCAGG + Intergenic
1029350476 7:100009784-100009806 GAAGGTGGCCAGGGAGGGGCAGG + Intergenic
1029457268 7:100677638-100677660 CAGTGTGGCCAGGCAGCTCCCGG - Exonic
1029677528 7:102080644-102080666 CAGGGTGGCGAGGAGACTGCTGG - Intronic
1030061068 7:105621752-105621774 GAGAGAGGCCAGGGAGCTGCTGG - Intronic
1030820139 7:114084789-114084811 GAGGAGGGCCGGGAAGCAGCCGG + Intergenic
1031999353 7:128254653-128254675 GGGGGTGTCCTGGAAGCTTCAGG + Exonic
1032742188 7:134749977-134749999 GAGGGCTCCCAGAAAGCTGCTGG + Intronic
1033289538 7:140071628-140071650 AAGGGTGGCCAGGGAACTGCCGG - Intergenic
1033344380 7:140515906-140515928 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1033597963 7:142870123-142870145 GAGGGTGGGCTGGAATCTGGTGG - Intronic
1034491447 7:151395181-151395203 GACGGAGCCCAGGAGGCTGCCGG + Intronic
1034700314 7:153089579-153089601 GAGGCTGGACAGGCAGTTGCAGG + Intergenic
1035099004 7:156381339-156381361 GAGGGTCTCCAGGCAGCTGTTGG - Intergenic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1035745544 8:1959991-1960013 GATGGGGGCCCGGAAGCTGGGGG - Intergenic
1035751212 8:1997689-1997711 GGTGGTGGACAGGGAGCTGCTGG + Intronic
1036288013 8:7461907-7461929 GAGGTTGGGTAGGATGCTGCAGG + Intronic
1036333463 8:7849621-7849643 GAGGTTGGGTAGGATGCTGCAGG - Intronic
1036521271 8:9493912-9493934 GAGGGTGGGGAGGAGGGTGCTGG - Intergenic
1036693812 8:10961641-10961663 CAGTGTTGCCAGGAAGCTGGAGG - Intronic
1036824375 8:11964929-11964951 GAGGCTGGACAGGAAGCTGCCGG + Intergenic
1037170745 8:15888769-15888791 GAGGGTGGGATGGAAGCTTCAGG + Intergenic
1039006967 8:33050370-33050392 GAGGGCAATCAGGAAGCTGCAGG - Intergenic
1039579367 8:38651228-38651250 GAGGGAGGCCAGGAGGAGGCCGG - Intergenic
1039921263 8:41896119-41896141 GCGGGTGGCCGGGAGGCTGAGGG - Intronic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1040959413 8:53015341-53015363 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1041315660 8:56559539-56559561 AAGGGTGGCCGAGAAGCAGCTGG - Intergenic
1043290212 8:78589597-78589619 GGGGGTGGGCAGGGAACTGCTGG + Intronic
1044917082 8:97126295-97126317 GAGGTTGGACAGGTAGCTGCTGG + Intronic
1044958527 8:97506352-97506374 AAGGGTGACCAGGAAGATGGAGG + Intergenic
1047526089 8:125635345-125635367 AATGGTGGTCATGAAGCTGCAGG + Intergenic
1047603561 8:126451532-126451554 GAGGGTGCTCAGGAACCTGTAGG - Intergenic
1048177544 8:132166429-132166451 GAGGGGGTACAGGAAGATGCTGG - Intronic
1048747233 8:137627588-137627610 GAGGGAGGCCAGGGGACTGCAGG - Intergenic
1049151387 8:141037534-141037556 GAGGGTGACAGGGAAGCGGCTGG + Intergenic
1049204421 8:141357000-141357022 GACGGTGGCCTGGAAGCCACTGG + Exonic
1049216851 8:141412266-141412288 CAGGGTGTCCAGGAAGCTTGTGG - Intronic
1049267297 8:141675279-141675301 GAGGGCGCCCAGGAAGGAGCTGG - Intergenic
1049357622 8:142196505-142196527 CAGGGTGGCCCGGAAGCTCATGG + Intergenic
1049404327 8:142444963-142444985 GAGGGGGGCCAGGATGCACCAGG + Intergenic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049708661 8:144054051-144054073 GAGAGTGGCCTGGAGGCTGGGGG - Intronic
1049726272 8:144147965-144147987 GCGGGTGGCCAGAAGGCAGCGGG + Intergenic
1049847131 8:144808295-144808317 GAGGGTGGACAGCCGGCTGCAGG - Exonic
1050081702 9:1922272-1922294 GAGGCTGGCCAGATAGCTGCTGG + Intergenic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1052470900 9:28895450-28895472 GAGGGTGGACAGGCAGTTTCTGG - Intergenic
1053464503 9:38295821-38295843 GAGGGTGGGCAAGATGGTGCAGG - Intergenic
1053654153 9:40198040-40198062 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1053904542 9:42827216-42827238 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054366267 9:64344256-64344278 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054530442 9:66178299-66178321 GAGGGTGGCCAGGGAGAAGGGGG - Intergenic
1054673898 9:67833986-67834008 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054830257 9:69617078-69617100 GAGGTTGGACAGGCAGTTGCTGG - Intronic
1055785222 9:79863772-79863794 GAAGGCGGCCAGGAAGGTGCTGG + Intergenic
1055829137 9:80359453-80359475 GAAGGCGGCCCGGAAGGTGCTGG - Intergenic
1055882981 9:81024063-81024085 GAGAGCCCCCAGGAAGCTGCTGG - Intergenic
1056041187 9:82669332-82669354 GAAGGTGGCCAGGCAGGTTCAGG + Intergenic
1056378295 9:86035373-86035395 GAGGAGGAGCAGGAAGCTGCCGG - Exonic
1056695548 9:88847272-88847294 GAGAGAGGCAAGAAAGCTGCAGG - Intergenic
1056712417 9:89001577-89001599 GGCGATGGCCAGTAAGCTGCAGG - Exonic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1056814662 9:89792456-89792478 GACTGTGGCCAGGAGGCTGGAGG - Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057275617 9:93674663-93674685 GAGGCTGGGCAGGTAGATGCAGG + Intronic
1057379702 9:94556270-94556292 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1058154484 9:101499597-101499619 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1058211811 9:102178031-102178053 GAGGGTGGCTTGGCAGCAGCAGG + Intergenic
1059310989 9:113389091-113389113 GAGGGAGGTCAGGGTGCTGCAGG + Exonic
1059637776 9:116187515-116187537 GAAGGTGGCCAGGACTCAGCGGG + Exonic
1060460471 9:123848929-123848951 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1061400842 9:130367536-130367558 GAGGGTGACCAGGCAACTGGTGG - Intronic
1061486038 9:130920961-130920983 GTGGGAGGCCTGGAGGCTGCTGG + Intronic
1061740212 9:132697982-132698004 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1062079952 9:134618571-134618593 CAGGGTGGACATGAGGCTGCGGG + Intergenic
1062174143 9:135151645-135151667 GAGGGCGGCCTGGAGGCTGGGGG - Intergenic
1062185384 9:135215532-135215554 GAGGCAGGCCAGGGAGCGGCAGG + Intergenic
1062285816 9:135772053-135772075 GACGGCGGCCGGGAACCTGCGGG - Intronic
1062485552 9:136773381-136773403 GGGAGTGGCCTGGAAACTGCTGG + Intergenic
1062647322 9:137555287-137555309 GCAGGTGGCCAGGAGGCTGAAGG + Exonic
1203699032 Un_GL000214v1:120521-120543 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203699990 Un_GL000214v1:126831-126853 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203700895 Un_GL000214v1:132815-132837 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203479730 Un_GL000224v1:1395-1417 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203480698 Un_GL000224v1:7691-7713 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203481659 Un_GL000224v1:14021-14043 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1203550191 Un_KI270743v1:160649-160671 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1203567692 Un_KI270744v1:105532-105554 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203568753 Un_KI270744v1:112517-112539 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203569331 Un_KI270744v1:116769-116791 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203570280 Un_KI270744v1:123050-123072 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1185459232 X:326919-326941 GACGGTGGCCAGGAAAATGGTGG + Intergenic
1189337951 X:40182216-40182238 GAGGTGAGCCAGGAAGCAGCAGG - Intergenic
1190595063 X:52044140-52044162 GAGGATGGGCAGGAAGGTGAAGG + Intergenic
1190613761 X:52209933-52209955 GAGGATGGGCAGGAAGGTGAAGG - Intergenic
1191677715 X:63809253-63809275 CAGGGTAGCCAGGCAGTTGCTGG - Intergenic
1192522799 X:71816326-71816348 GGGGATGGACAGGCAGCTGCTGG - Intergenic
1196798189 X:119519211-119519233 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1196861676 X:120034505-120034527 GAGGGTGGCACAGAAGCTGGTGG + Intergenic
1197752669 X:129976247-129976269 GAGAGTGGTCAGCAAGCTGAAGG + Intergenic
1199545666 X:149005313-149005335 GGGGGTGGCCAGGATGCTTTGGG - Intergenic
1200148911 X:153941976-153941998 GAGGGTGGCAAGGAACTTCCTGG - Exonic
1200373651 X:155756151-155756173 AAGGGAGGCCAGCATGCTGCAGG - Intergenic
1201143774 Y:11050425-11050447 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1201593560 Y:15641125-15641147 TAGTGTGAGCAGGAAGCTGCAGG - Intergenic
1202272858 Y:23087311-23087333 AATGGTAGCCAGGAAACTGCTGG - Intergenic
1202293168 Y:23333371-23333393 AATGGTAGCCAGGAAACTGCTGG + Intergenic
1202425855 Y:24721055-24721077 AATGGTAGCCAGGAAACTGCTGG - Intergenic
1202444934 Y:24949031-24949053 AATGGTAGCCAGGAAACTGCTGG + Intergenic