ID: 1117331846

View in Genome Browser
Species Human (GRCh38)
Location 14:54720472-54720494
Sequence TGAGTCCCACAAAAACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117331846_1117331848 10 Left 1117331846 14:54720472-54720494 CCTGGCTGTTTTTGTGGGACTCA 0: 1
1: 0
2: 1
3: 22
4: 201
Right 1117331848 14:54720505-54720527 CATCTGCAATTCTTTTCTCATGG 0: 1
1: 0
2: 3
3: 24
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117331846 Original CRISPR TGAGTCCCACAAAAACAGCC AGG (reversed) Intronic
900016648 1:155300-155322 TGATTCTCACAAAAACAGGTGGG - Intergenic
900046909 1:513892-513914 TGATTCTCACAAAAACAGGTGGG - Intergenic
900069113 1:755610-755632 TGATTCTCACAAAAACAGGTGGG - Intergenic
900842080 1:5059929-5059951 TCACTGCCACAAAAACAGCACGG + Intergenic
902107792 1:14052185-14052207 TGAGTCCCCCCAACCCAGCCAGG + Intergenic
902705868 1:18203927-18203949 TGGGTCCTACAGAAACAGGCTGG + Intronic
903817905 1:26078520-26078542 TTAGTCCTACAAAAGCAGACTGG - Intergenic
907425529 1:54376918-54376940 TGACTCACACACAAAGAGCCTGG + Intronic
911418591 1:97609523-97609545 TGAGCCCCACAAAAACACTATGG + Intronic
912023506 1:105138084-105138106 AGAGGCCCAGATAAACAGCCTGG - Intergenic
912790970 1:112650318-112650340 TGAGTTCCAAAAAAGCAGCATGG - Intronic
913347324 1:117821276-117821298 AGAGGCCCAGATAAACAGCCTGG - Intergenic
914251559 1:145926117-145926139 TGAGTCCCTCCATAGCAGCCTGG + Intergenic
915775519 1:158480735-158480757 TGTGTCCAACAAAGACAGGCTGG + Exonic
917078662 1:171234297-171234319 TCACTCTCACAAAAACAGCATGG - Intergenic
917328521 1:173858347-173858369 TGATTCCAGCAATAACAGCCCGG - Exonic
919649545 1:200132899-200132921 TGAGTCCCAGAACATCAGCATGG + Intronic
919725566 1:200880608-200880630 TGGGTCCCACAAACACAGAGTGG + Intergenic
921308292 1:213818761-213818783 TCAGTCCCACTGAAACAGCTTGG + Intergenic
922104475 1:222501002-222501024 TGATTCTCACAAAAACAGTTGGG - Intergenic
922244927 1:223786899-223786921 TTTGTCTCACAAAAAAAGCCGGG - Intronic
922264794 1:223973517-223973539 TGATTCTCACAAAAACAGTTGGG - Intergenic
923339393 1:232994737-232994759 TCACTATCACAAAAACAGCCTGG - Intronic
924346652 1:243078521-243078543 TGATTCTCACAAAAACAGGTGGG - Intergenic
1062958272 10:1554273-1554295 GGAGCCCCACGAAAACAGCCAGG - Intronic
1066269774 10:33810954-33810976 TCAGTCCACCAAAAACACCCAGG + Intergenic
1066729699 10:38426328-38426350 TGATTCTCACAAAAACAGGTGGG + Intergenic
1068244264 10:54343267-54343289 TCACTCTCACAAAAACAGCAGGG - Intronic
1069074884 10:64028726-64028748 TGACTTCCAGAAAAGCAGCCTGG - Intergenic
1070609102 10:77921402-77921424 TTAGTCCCACTAGAAAAGCCTGG + Intronic
1072454139 10:95561387-95561409 TGAGTCCCAGAAAAACAGAGCGG - Intronic
1074764713 10:116692127-116692149 TCAGTCCCACAACAAGAGCTGGG - Intronic
1076973239 11:150369-150391 TGATTCTCACAAAAACAGGTGGG - Intergenic
1077574412 11:3370639-3370661 AGAGTTCCTCAAAAACAGGCAGG + Intronic
1079735495 11:23992740-23992762 TGAGTCCTATAAAAAAAGACAGG - Intergenic
1080233702 11:30045726-30045748 AGAGACCCAGATAAACAGCCTGG + Intergenic
1081700308 11:45148321-45148343 TGAGTCCAACAAAACCTGCCCGG + Intronic
1084676582 11:70639061-70639083 TGAGTCTCACAGAGCCAGCCTGG + Intronic
1089739254 11:120571117-120571139 GAAGTCCCAGGAAAACAGCCGGG - Intronic
1090666957 11:128920736-128920758 TGCCTCCCAAACAAACAGCCGGG + Exonic
1091059252 11:132446220-132446242 TGAGTGTCACAGAAACAGCCAGG + Intronic
1091144496 11:133265810-133265832 GCAGTCCCACAAAAACAGAAGGG + Intronic
1093417833 12:18940853-18940875 TGAGTCGCAGAACAACAGCCTGG + Intergenic
1097966166 12:65583661-65583683 TGATTCCCATTTAAACAGCCTGG - Intergenic
1098245041 12:68508303-68508325 TCACTCCCACAAGAACAGCATGG + Intergenic
1100618058 12:96247089-96247111 CGAGGCCCACAAACACGGCCTGG + Exonic
1102201013 12:111057663-111057685 TGACTCCCACCTCAACAGCCTGG + Intronic
1104200268 12:126582261-126582283 TGAGTCCCCTAAAGACAGACTGG - Intergenic
1104346805 12:128007435-128007457 TGACTCCCACAGCCACAGCCTGG - Intergenic
1105644707 13:22304335-22304357 TCACTCCCACAAGAACAGCATGG + Intergenic
1107894511 13:44947702-44947724 AGAATCCCATAAAAACAGGCTGG - Intronic
1108238086 13:48429936-48429958 TTTGTCCCAGAAAAACTGCCTGG - Intronic
1108540790 13:51442825-51442847 TGTCTTCCACAAAACCAGCCTGG + Intronic
1108946903 13:56038022-56038044 TGAGGCCCCCAAAAACAACTAGG + Intergenic
1109062211 13:57633248-57633270 TGACTCCAACGACAACAGCCCGG + Exonic
1109943373 13:69400482-69400504 TGAGTCTCACAATAACACCGAGG + Intergenic
1113014801 13:105816947-105816969 TGAGTTCCACAAGAACTGCAAGG + Intergenic
1113450580 13:110406612-110406634 AGAGTCCCACTAAAAAAACCAGG - Intronic
1115184938 14:30676414-30676436 TGAGAACAACAAAAACAGCAGGG + Intronic
1115481584 14:33866592-33866614 TGAGTACCACCCAATCAGCCAGG - Intergenic
1117090323 14:52243812-52243834 TGACTATCACAAAAACAGCATGG + Intergenic
1117331846 14:54720472-54720494 TGAGTCCCACAAAAACAGCCAGG - Intronic
1117889013 14:60398137-60398159 TGAGTCCCTCCATAGCAGCCTGG - Intronic
1123927980 15:25137197-25137219 TGAGTTCCACGAAAGCAGCGAGG + Intergenic
1125343048 15:38693663-38693685 AGAGGCCCACAAAAGCTGCCTGG - Intergenic
1126608143 15:50501785-50501807 TGGGTCTTACAAAAACAGCCTGG - Exonic
1127509757 15:59628955-59628977 TGAGTCTCACTCTAACAGCCAGG + Intronic
1127604240 15:60570146-60570168 TCAGTAACACAAACACAGCCCGG + Intronic
1128338198 15:66802127-66802149 TGGGTCCCGTAAAACCAGCCTGG + Intergenic
1133966365 16:10534871-10534893 ATAGTCCCACCAAAACTGCCTGG - Intronic
1134656562 16:15951983-15952005 TGAAAAACACAAAAACAGCCGGG - Intronic
1135849577 16:25951004-25951026 TGCTTCCTACAAAAACAGCTGGG - Intronic
1139043807 16:63032403-63032425 TGAGTCCCACAAATTCATTCTGG + Intergenic
1139793795 16:69464927-69464949 TGTTGCCTACAAAAACAGCCAGG + Exonic
1139867497 16:70074279-70074301 TAAGATCCACAAAAATAGCCAGG - Intergenic
1142447012 16:90147157-90147179 TGATTCTCACAAAAACAGGTGGG + Intergenic
1142460480 17:88174-88196 TGATTCTCACAAAAACAGGTGGG - Intergenic
1143336276 17:6173936-6173958 GGAGCTCCACAAAGACAGCCTGG + Intergenic
1143885420 17:10061453-10061475 TGACTCCCACAAACAGCGCCAGG + Intronic
1147175353 17:38652696-38652718 TGAGTTGCAGAAAAACAGGCAGG - Intergenic
1147181780 17:38691069-38691091 TCAGTCCCACAGAATCAACCTGG - Intergenic
1149072341 17:52557351-52557373 TCACTATCACAAAAACAGCCTGG - Intergenic
1150505999 17:65699786-65699808 TGTGGCCAACAAAAACAGCCAGG - Intronic
1152401939 17:80071624-80071646 TGAGTCCCACACAACCTCCCTGG + Intronic
1152902308 17:82949878-82949900 TGAGTGCCACAACACCAGCGTGG + Intronic
1154172979 18:12063983-12064005 TGAGTGACACACACACAGCCAGG - Intergenic
1156315869 18:35968176-35968198 TTAGTCCTACAAAGGCAGCCTGG + Intergenic
1156857713 18:41801954-41801976 TGTGTACCCCAAAAAAAGCCAGG - Intergenic
1158226329 18:55205302-55205324 TGAGTCACAAAATAACAGCTTGG - Intergenic
1159028034 18:63204400-63204422 TGGGTCCCACAAAAACAGAGAGG - Intronic
1160624521 18:80193883-80193905 CAAGTGCCACAAAAACAGTCGGG + Intronic
1160650195 19:220674-220696 TGATTCTCACAAAAACAGGTGGG - Intergenic
1162199642 19:9010953-9010975 TGAGTCCTACAAAACCACCTCGG + Intergenic
1162476709 19:10904815-10904837 AGAGTGCCACAAAACCACCCTGG - Intronic
1162915724 19:13873412-13873434 TGAGGCCCAAAATAACCGCCTGG - Intronic
1163175915 19:15564017-15564039 TGAGGCCCAGAAAAAGAGCCCGG - Intergenic
1163709771 19:18839744-18839766 TCAGTCCCACAAGCACAGCAAGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1167408207 19:49328328-49328350 TCACTATCACAAAAACAGCCTGG + Intergenic
927779010 2:25924473-25924495 TGAGCCCCACAGAAACAGCCAGG - Intergenic
930113411 2:47698255-47698277 TTAGTCCTACAAAGACAGACTGG - Intronic
930525856 2:52528960-52528982 TGTGTCTAACAAAAACAGGCTGG + Intergenic
930971852 2:57406102-57406124 TGAGTCCCAGAAACTCAGGCAGG + Intergenic
931669966 2:64638330-64638352 GGAGTCCCACATGAACACCCTGG + Intronic
935976840 2:108586651-108586673 TGAGTCCCAGCAGAACATCCTGG - Intronic
938127784 2:128686935-128686957 TGAGGCCCACAGAGAAAGCCCGG - Intergenic
939844713 2:147229187-147229209 TTAGTCCCACAAAGGCAGACTGG - Intergenic
942441652 2:176043081-176043103 TCACTACCACAAGAACAGCCTGG - Intergenic
945196725 2:207243725-207243747 TGATTCACACACAAACATCCTGG - Intergenic
945326605 2:208489369-208489391 TTCGTCACACAAAAAAAGCCTGG + Intronic
946166206 2:217865588-217865610 TAAGTCCCAGATAAGCAGCCAGG + Intronic
947032374 2:225811611-225811633 TCACTACCACAAAAACAGCATGG + Intergenic
948379175 2:237541111-237541133 TGAGTCCCCCAGAAACCCCCAGG - Intronic
948916540 2:241037319-241037341 TGGGTCCCCCAAAGCCAGCCGGG - Exonic
1169128516 20:3149174-3149196 GGTGTTCCACAAAAACTGCCTGG + Exonic
1170697596 20:18673765-18673787 AGAGTCCCACAAAACCACCCTGG + Intronic
1171169034 20:22999170-22999192 TGATTCCCACAGAAAGAGGCTGG + Intergenic
1171992739 20:31708944-31708966 TGAGTCCCAAAATAACAACCAGG + Intronic
1172680632 20:36711782-36711804 TCCGTCTCAAAAAAACAGCCAGG - Intronic
1172761551 20:37326889-37326911 TGATTCACAGAAAACCAGCCTGG - Intergenic
1173797546 20:45872854-45872876 TGAGTCTCACAGTAACAGGCTGG - Intronic
1175905652 20:62378153-62378175 TGGGTCCCACAAGAACTTCCAGG + Intergenic
1175926312 20:62473277-62473299 GGAGTGTCCCAAAAACAGCCTGG - Intronic
1175974817 20:62705453-62705475 TGAGTCCCTCCAACACTGCCCGG - Intergenic
1176013530 20:62914516-62914538 TGTGACCCACAAAGACAGCTTGG + Intronic
1176942467 21:14940534-14940556 TCAGTGCCACAGTAACAGCCAGG + Intergenic
1177159182 21:17529324-17529346 TGTGTCTCAAAAAAAAAGCCAGG - Intronic
1177652021 21:23969332-23969354 AGAGGCCCAGAAAAGCAGCCTGG - Intergenic
1177842817 21:26253465-26253487 TGAGTCCCATAGAGAAAGCCAGG + Intergenic
1178140241 21:29674582-29674604 TCACTACCACAAGAACAGCCTGG - Intronic
1185279749 22:49964977-49964999 AGAGTCCCTGATAAACAGCCCGG + Intergenic
949895098 3:8762689-8762711 TCAGTCCCACAGAAACAGGGAGG + Intronic
951345404 3:21542627-21542649 TGTGTGCCACTGAAACAGCCAGG + Intronic
951563081 3:23987445-23987467 TCACTCTCACAAGAACAGCCAGG - Intergenic
952625501 3:35397871-35397893 TGAGTCCCAGGAAAACAGAGAGG - Intergenic
955776930 3:62443578-62443600 TCAGTATCACAAGAACAGCCTGG - Intronic
958988198 3:100808160-100808182 AGAATCCCACAAACACAACCAGG - Exonic
959023882 3:101218785-101218807 GGAGTCTCTCAAGAACAGCCTGG + Intergenic
959142543 3:102504053-102504075 TTAGTATCACAAAAACAGCATGG - Intergenic
960877181 3:122308953-122308975 TTAGTCCTACAAAGACAGACCGG - Intergenic
961017176 3:123477316-123477338 TGAGTCCTACAAAAATATCTTGG - Intergenic
964082654 3:152777669-152777691 TGAATCCCACAAAAATTGCCTGG + Intergenic
964264243 3:154875812-154875834 TGATACCCACAAAAACAGTCTGG + Intergenic
968367652 3:198199455-198199477 TGATTCTCACAAAAACAGGTGGG + Intergenic
968704624 4:2072182-2072204 TGAGTCTCCCAGCAACAGCCTGG - Exonic
968876020 4:3268384-3268406 TGTCTCCCACAGAAGCAGCCAGG - Intronic
969252786 4:5980649-5980671 AGAGTCCCAGAATAACAGCCTGG + Intronic
969482020 4:7451742-7451764 TGGGACTCACAAAACCAGCCTGG - Intronic
970301649 4:14687259-14687281 TCACTATCACAAAAACAGCCTGG - Intergenic
970648124 4:18146620-18146642 TGAGCCACACAACAGCAGCCTGG - Intergenic
972435369 4:39028678-39028700 TAAGTCCAACAAAAACAGGTTGG + Intronic
974481485 4:62449424-62449446 TAAGTCCCACCACAACAGCTTGG - Intergenic
977610441 4:99024750-99024772 TTAGTCCCACAAAGGCAGTCTGG + Intronic
979256066 4:118609167-118609189 TGATTCTCACAAAAACAGGTGGG + Intergenic
979332278 4:119431370-119431392 TGATTCTCACAAAAACAGGTGGG - Intergenic
979673519 4:123385843-123385865 TGACTATCACAAAAACAGCAGGG + Intergenic
980266420 4:130523202-130523224 TCACTACCACAAAAACAGCATGG + Intergenic
980995536 4:139776598-139776620 TGATCCCCACAAAAACAGGATGG + Intronic
981439240 4:144764142-144764164 TGAGTCCCTCAAAGTCATCCAGG + Intergenic
984710411 4:182879802-182879824 TGTGTCCCCCCAAAACAGCAGGG - Intergenic
986939658 5:12935530-12935552 AGAGGCCCAGATAAACAGCCTGG + Intergenic
987804679 5:22748903-22748925 TGACTCCAGCAAAAATAGCCTGG - Intronic
989272652 5:39551067-39551089 TGAGTCCAACAAAAACAGAGTGG - Intergenic
989333495 5:40287663-40287685 TTAATCCCACAAAAATACCCTGG - Intergenic
989434800 5:41398261-41398283 TCACTATCACAAAAACAGCCAGG - Intronic
990477638 5:56176385-56176407 TCAGTCCCATACAAACAGCTGGG - Intronic
990924378 5:61003591-61003613 TGAATCCCAGAAAAATATCCTGG + Intronic
994695937 5:103073634-103073656 TCAGTACCACAAGAACAGCATGG - Intergenic
997299094 5:132789349-132789371 TGGGTCCCACCAAGACAGCCTGG - Intronic
997897672 5:137734404-137734426 TGACTCCCACAGGAAGAGCCTGG - Intronic
1000444319 5:161301233-161301255 TGAGTCCCCTAAATATAGCCTGG - Intronic
1002726872 5:181304684-181304706 TGATTCTCACAAAAACAGGTGGG + Intergenic
1003484567 6:6564462-6564484 TCAGTATCACAAAAACAGCAGGG + Intergenic
1005143388 6:22660161-22660183 TCATTCCCACAAATACATCCAGG + Intergenic
1006909310 6:37553878-37553900 TGAGTCACACAAACACCTCCAGG + Intergenic
1007123368 6:39401958-39401980 TGACTCCCAAAATACCAGCCAGG - Intronic
1007258608 6:40546093-40546115 TGTGATCCTCAAAAACAGCCAGG - Intronic
1008939282 6:57029088-57029110 TTAGTCCTACAAAAGCAGACTGG - Intergenic
1009909193 6:69904758-69904780 GGAGGCCCAGATAAACAGCCTGG - Intronic
1010254387 6:73741201-73741223 TAAGTAGCACAAAAAGAGCCAGG - Intronic
1014342722 6:120229309-120229331 TCAGTCTCACAGAAACAGCATGG + Intergenic
1016139903 6:140595227-140595249 TCACTCTCACAAAAACAGCATGG - Intergenic
1016866164 6:148769152-148769174 TGAGCTCCTCAACAACAGCCTGG + Intronic
1017491054 6:154945368-154945390 TGAGTCCCAGAAAGGCTGCCTGG - Intronic
1017793518 6:157822690-157822712 TGAGTACCACATAAACAGCTGGG - Intronic
1018090328 6:160341083-160341105 TGAGTCCCAAAGAAACAGAAGGG - Intergenic
1019294434 7:266469-266491 TGAGTCCCAAAAGGACAGCCTGG - Intergenic
1019921178 7:4164173-4164195 TGGGAACCACGAAAACAGCCTGG + Intronic
1023411347 7:39891911-39891933 TGAGTCCTACAAAGATAGACTGG - Intergenic
1023624702 7:42104445-42104467 TGAATCCCATAAACACAGCAAGG + Intronic
1024520741 7:50303194-50303216 TGAATTCCACAAATGCAGCCTGG - Intergenic
1025134464 7:56398960-56398982 TGATTCTCACAAAAACAGGTGGG - Intergenic
1028487002 7:91370725-91370747 AGACTCACACAAATACAGCCAGG - Intergenic
1028509420 7:91607412-91607434 TGAGTGCCACAAAAATTGCAAGG + Intergenic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1030141438 7:106308127-106308149 TGAATCCCACAAAGACAGCTAGG - Intergenic
1030690001 7:112522601-112522623 TGAGTCACAGCAAAAGAGCCTGG - Intergenic
1032048386 7:128629903-128629925 TGATTCTCACAAAAACAGGTGGG + Intergenic
1032404850 7:131648618-131648640 TGGGTCCCACACAGACAGCCAGG - Intergenic
1032855349 7:135829232-135829254 TGATTCCTAGAAAAACATCCTGG + Intergenic
1034373372 7:150621441-150621463 TGAGTCACAGATAAAGAGCCTGG + Intergenic
1038717541 8:30005333-30005355 TCACTCTCACAAGAACAGCCTGG + Intergenic
1041004232 8:53483754-53483776 GGAGGCCCAGATAAACAGCCTGG + Intergenic
1043030870 8:75131663-75131685 TCACTGTCACAAAAACAGCCCGG - Intergenic
1045242005 8:100410734-100410756 TGAGTGACACAAACACAGCTTGG - Intergenic
1047636688 8:126771213-126771235 TGAGACTCTCAAAACCAGCCTGG - Intergenic
1049185653 8:141251293-141251315 TCAGTTCCACGAACACAGCCAGG + Intronic
1056098772 9:83280427-83280449 TGAGTCACCCAAACACAGTCAGG - Intronic
1059680236 9:116578856-116578878 TGAGCAGCAGAAAAACAGCCTGG + Intronic
1062751993 9:138262160-138262182 TGATTCTCACAAAAACAGGTGGG + Intergenic
1185913920 X:4013851-4013873 TGAGTCTCACAGCAACTGCCAGG + Intergenic
1186207183 X:7213166-7213188 TGGGACACACAAAAACAGCCAGG + Intergenic
1186207250 X:7213717-7213739 TGGGACACACAAAAACAGTCAGG - Intergenic
1186217555 X:7316050-7316072 TGAGTCCCACGAAAATGTCCTGG - Intronic
1186888792 X:13939582-13939604 TTAGTCCTACAAAAACTGCAAGG - Intergenic
1187667534 X:21629620-21629642 TGAGTCTTACAAGAACAGCATGG + Intronic
1188141112 X:26553074-26553096 TCACTCTCACAAGAACAGCCCGG + Intergenic
1189384024 X:40521910-40521932 TGAGTCCCCCCAAAACAGACAGG - Intergenic
1191666714 X:63709893-63709915 TGATACCCACAGAGACAGCCAGG + Intronic
1192146351 X:68685533-68685555 CGTGTACCACAAAAAAAGCCTGG - Intronic
1194126859 X:90029266-90029288 TGAGTATCACAAAAATAGCATGG + Intergenic
1194582709 X:95696509-95696531 TCACTACCACAAAAACAGCATGG - Intergenic
1195620794 X:106952626-106952648 TGAGTCCCACAAATCTAGCAAGG - Intronic
1197397356 X:125942801-125942823 TGAGGCCCTCAAAAGAAGCCAGG - Intergenic
1199729210 X:150614286-150614308 AGAATCCCACAGAAACAGGCTGG + Intronic