ID: 1117332701

View in Genome Browser
Species Human (GRCh38)
Location 14:54728965-54728987
Sequence CTTGAGCTGAACCGCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117332701_1117332704 15 Left 1117332701 14:54728965-54728987 CCTGGCCTGCGGTTCAGCTCAAG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1117332704 14:54729003-54729025 CACAGTTTTAAAATATCCTTTGG 0: 1
1: 0
2: 8
3: 60
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117332701 Original CRISPR CTTGAGCTGAACCGCAGGCC AGG (reversed) Intronic
900498951 1:2990261-2990283 ATTCAGCTGAACCGAGGGCCAGG - Intergenic
900659554 1:3775756-3775778 CTGGAGGTGAGCCCCAGGCCAGG - Intronic
901076021 1:6555192-6555214 CCTGAGTGGGACCGCAGGCCCGG + Exonic
902800468 1:18826452-18826474 CATGAGGTGAAGAGCAGGCCAGG + Intergenic
903221858 1:21873702-21873724 CTGAAGGTGAACCGCAGGCTAGG + Intronic
904034353 1:27550973-27550995 CTTGGGGTGACCCTCAGGCCCGG + Exonic
904411593 1:30328236-30328258 GATGAGCTGAACCCCATGCCTGG + Intergenic
1076789881 10:132771266-132771288 CTTGTGTTGAACCCCAGGCCTGG - Intronic
1097820869 12:64128039-64128061 CCTGAGCGGAGGCGCAGGCCTGG + Exonic
1102457000 12:113077221-113077243 CCTGTGCTGAACCTCATGCCTGG + Intronic
1103698525 12:122835578-122835600 CGGGTGCTGAGCCGCAGGCCGGG + Exonic
1105241024 13:18609758-18609780 CTGGAGCTAACCCGCGGGCCTGG + Intergenic
1114539931 14:23447522-23447544 CTGGAGCAGAACAGTAGGCCTGG - Intergenic
1116127514 14:40807474-40807496 CTTGAGATGGTCCCCAGGCCGGG + Intergenic
1116821748 14:49633997-49634019 CGCGAGCGGAAGCGCAGGCCTGG + Exonic
1116996344 14:51329014-51329036 CATGAGTTGAACAGCAGGCAGGG + Intergenic
1117072680 14:52069954-52069976 CCTGAGCTGCTCCGCAGGACTGG + Intergenic
1117332701 14:54728965-54728987 CTTGAGCTGAACCGCAGGCCAGG - Intronic
1120765178 14:88322327-88322349 CTGGAGCTGCGCCGCATGCCCGG - Intronic
1120893298 14:89508249-89508271 TTTGAGCTGAGCCACAAGCCTGG - Intronic
1202905816 14_GL000194v1_random:71961-71983 CCTGAGCTGACCCTCAGGCCTGG + Intergenic
1123490333 15:20775387-20775409 CTGGAGCTAACCCGCGGGCCTGG - Intergenic
1123546834 15:21344474-21344496 CTGGAGCTAACCCGCGGGCCTGG - Intergenic
1126688798 15:51271293-51271315 CTTTAGGTGACTCGCAGGCCTGG - Intronic
1128065508 15:64762120-64762142 CATGAGCTGAAGACCAGGCCAGG - Intronic
1129628296 15:77229510-77229532 CTTGAGCTGAGCCTCATGCATGG - Intronic
1129895130 15:79099546-79099568 CTAGAGCTCAGCAGCAGGCCAGG + Intergenic
1202955166 15_KI270727v1_random:71690-71712 CTGGAGCTAACCCGCGGGCCTGG - Intergenic
1135114893 16:19716080-19716102 CTTGACCTGTAGCTCAGGCCTGG - Intronic
1135341701 16:21653827-21653849 CCTCAGCTGCACGGCAGGCCAGG + Intronic
1135547679 16:23376960-23376982 CCTGAGCTGGGCCCCAGGCCAGG + Intronic
1135898528 16:26433053-26433075 CTTTAGCTGAAGCGCAGGTCAGG + Intergenic
1136478500 16:30527154-30527176 CCGGAGCTGACCCGGAGGCCCGG - Intronic
1140864479 16:79048191-79048213 TTTGAACTGAAGGGCAGGCCAGG + Intronic
1141224483 16:82102054-82102076 CTTGAGCAGAACAGCAGGACTGG - Intergenic
1142993608 17:3748028-3748050 CTTCAGGCGAACCACAGGCCGGG + Exonic
1145817835 17:27808268-27808290 CTCAAGCTGAACTGCAGGGCAGG - Intronic
1145977724 17:28993855-28993877 TTTGAGCTGAATCACCGGCCTGG + Intronic
1149628121 17:58094528-58094550 CTTGATCTGACTCCCAGGCCAGG + Exonic
1151674401 17:75590137-75590159 CTGGAGCTGAGCCTCCGGCCGGG + Intergenic
1152240155 17:79156781-79156803 CCTGAGCTGGACAGCAGGACAGG + Intronic
1152614861 17:81333403-81333425 CCAGAGCTGGACAGCAGGCCTGG + Intergenic
1152778277 17:82215421-82215443 CTTCAGCTGAGCCACATGCCCGG + Intergenic
1154447939 18:14450144-14450166 CTGGAGCTAACCCGCGGGCCTGG - Intergenic
1157926125 18:51767828-51767850 CTAGAGTTGAACGTCAGGCCAGG - Intergenic
1159833549 18:73308044-73308066 CGAGAGCTGAACCACAAGCCAGG - Intergenic
1162785834 19:13034225-13034247 CTTGAGCTGAGCCGCAAGCTGGG - Intronic
1164616009 19:29667116-29667138 CTTGAGCTGCTCCCCAGGACCGG + Intronic
1167772364 19:51529425-51529447 CTTGAGCTGAATCCCTGGCAGGG + Intronic
926357768 2:12056971-12056993 CTAGAGCTGTCCCCCAGGCCAGG - Intergenic
927054266 2:19355382-19355404 GTTGAGCTGACCCTCAGCCCAGG + Intronic
929453844 2:42053117-42053139 CCTGAGCTGAAGCAAAGGCCTGG + Intronic
935349190 2:102139352-102139374 CCTGAGCCAAACAGCAGGCCTGG - Intronic
936253395 2:110886796-110886818 CTGGAGCTGAACAGCAGTTCTGG - Intronic
944229197 2:197376268-197376290 CTCTAGGTGACCCGCAGGCCCGG + Intergenic
948582425 2:238997181-238997203 CTGGTGCTGGAGCGCAGGCCTGG - Intergenic
1172870946 20:38135210-38135232 CATGAGGTGAACTCCAGGCCTGG - Intronic
1175634125 20:60566460-60566482 CCTGAGCTAAACTGCAAGCCTGG - Intergenic
1176011311 20:62897849-62897871 GTTGAGGTGCACCGCATGCCGGG + Intronic
1176448282 21:6840551-6840573 CTGGAGCTGACCCACGGGCCTGG + Intergenic
1176625173 21:9086718-9086740 CCTGAGCGGACCCTCAGGCCTGG + Intergenic
1176826452 21:13705573-13705595 CTGGAGCTGACCCACGGGCCTGG + Intergenic
1176970201 21:15256128-15256150 CCTGAGGTGACCTGCAGGCCTGG + Intergenic
1179903320 21:44406264-44406286 CTAGAGCTGAATCAGAGGCCAGG - Intronic
1179903329 21:44406330-44406352 CTAGAGCTGAATCAGAGGCCAGG - Intronic
1180848045 22:18995112-18995134 CTTGAGCTACAGCGCAGCCCTGG - Intergenic
1182816446 22:33168408-33168430 CTTGTGCTGAACCACAGGTTAGG + Intronic
1183163705 22:36132016-36132038 CCTGGGGTGAAACGCAGGCCTGG + Intergenic
1183284426 22:36953267-36953289 CTTGAGATGAACCCCAAGCCAGG + Intergenic
1183868677 22:40724089-40724111 CATGGGATGAACCGCCGGCCAGG - Intergenic
955740226 3:62082736-62082758 CTTGTGCTCAACAGCAGACCTGG - Intronic
961830089 3:129618901-129618923 CTTGAGCTGAGCCGGATGCATGG - Intergenic
971193238 4:24447453-24447475 ATTGGGCTGAAACTCAGGCCAGG + Intergenic
980997312 4:139792145-139792167 CATGAGCTGAATCGCATGCTTGG - Intronic
985732198 5:1555635-1555657 CTTGTGGTGAACCACAGGGCTGG + Intergenic
1001833419 5:174808816-174808838 CTGGAGCTGAAACCCAGTCCTGG - Intergenic
1007767811 6:44171307-44171329 CTTTAGCCGAACTTCAGGCCAGG + Intronic
1013175118 6:107669934-107669956 CTGGAGCTTAACCGTAGGTCAGG + Intergenic
1013944591 6:115706475-115706497 CTTGAACTGGACCACAGGTCAGG - Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1019061081 6:169258789-169258811 CTGGAGCTGAACCACAGGTGTGG + Intergenic
1019061743 6:169262397-169262419 CTGGAGCTGAACCACAGGTGTGG - Intergenic
1019135867 6:169907476-169907498 CATGAGCTCAGCTGCAGGCCAGG + Intergenic
1022297147 7:29066881-29066903 CTTTGGCTGAACCACAGCCCTGG - Intronic
1026589744 7:71684433-71684455 CTACAGCTGACCCGCAGCCCAGG + Intronic
1027444192 7:78253831-78253853 CAAGAGCTGAGTCGCAGGCCTGG - Intronic
1029348601 7:99997057-99997079 CCTCAGCTGAAACTCAGGCCTGG + Intergenic
1029552367 7:101244303-101244325 CAAGAGCTGGCCCGCAGGCCCGG - Intronic
1030008702 7:105143971-105143993 CTTGAGCTTCTCAGCAGGCCAGG + Intronic
1032394256 7:131577925-131577947 CTTGAGCTGGACTGGAGCCCTGG - Intergenic
1045651173 8:104342791-104342813 CTTGATCTGGACCTCAGACCAGG + Intronic
1046213908 8:111117009-111117031 CTTCAGATGAAATGCAGGCCTGG + Intergenic
1048329239 8:133461025-133461047 CTTGAGCAGAACCTCAAGCAAGG + Intronic
1051357869 9:16255870-16255892 CTTGAGCTGAGTAGAAGGCCAGG - Intronic
1056810259 9:89758315-89758337 CTTGAGCTGAGCAGCCAGCCAGG + Intergenic
1058634928 9:107029237-107029259 CCTGAGCTTAATCTCAGGCCAGG - Intergenic
1062021146 9:134319963-134319985 CTTGAGCTGAGACGCAGGGAGGG - Intronic
1203520909 Un_GL000213v1:43967-43989 CTGGAGCTGACCCACGGGCCTGG - Intergenic
1203748347 Un_GL000218v1:57178-57200 CCTGAGCGGACCCTCAGGCCTGG + Intergenic
1186523190 X:10223614-10223636 CCTGAGCTCCACCGCTGGCCTGG + Intronic