ID: 1117336766

View in Genome Browser
Species Human (GRCh38)
Location 14:54762613-54762635
Sequence CTGTGGGTCTCTCAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117336766_1117336773 18 Left 1117336766 14:54762613-54762635 CCTACTTCCTGAGAGACCCACAG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1117336773 14:54762654-54762676 TTACATTTTACCTACGTTAAAGG 0: 1
1: 1
2: 1
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117336766 Original CRISPR CTGTGGGTCTCTCAGGAAGT AGG (reversed) Intronic
901989426 1:13100716-13100738 CTGTGGGTTTTGCAGGATGTGGG + Intergenic
901992387 1:13126048-13126070 CTGTGGGTTTTGCAGGATGTGGG - Intergenic
902262900 1:15240209-15240231 ATGTGGGCCTTTCTGGAAGTTGG - Intergenic
903213825 1:21832482-21832504 CTGGGGGTCTCACCGGAACTCGG + Exonic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
904748643 1:32726884-32726906 CTTTGGGAGTCTCAGGAAGGTGG - Intergenic
905669223 1:39780199-39780221 CTCTGTGCATCTCAGGAAGTGGG + Intronic
906701496 1:47861524-47861546 TTGTGGGTCTTTCAAGGAGTTGG - Intronic
907147449 1:52248215-52248237 CTGGGGGTCTCTCAGGCCTTAGG - Intronic
910209636 1:84779881-84779903 CTGTGGGTCTTGGAGGAGGTTGG - Intergenic
910463714 1:87474636-87474658 CTGTGGCTCTCTTTGGAGGTCGG + Intergenic
911556128 1:99347146-99347168 CTGTGGGTGCCTCAAGAAGCAGG - Intergenic
915119103 1:153617447-153617469 CTGAGGGTCTCTCAGCCTGTGGG + Intergenic
916237962 1:162609426-162609448 CTCTGGTTCTCTCATGAGGTTGG + Intergenic
917210942 1:172631637-172631659 ATGTGGGCCTCTGAGGATGTTGG - Intergenic
917835100 1:178935355-178935377 TTGTCTGTCTCTAAGGAAGTAGG + Intergenic
918184555 1:182115411-182115433 CTGTGGGTCTCTCTAGGACTGGG - Intergenic
921166953 1:212514534-212514556 CTCTGGGCCTCTCACCAAGTAGG + Intergenic
922466045 1:225846067-225846089 CTGTGGCTCTGGCAGGAAGGAGG - Exonic
1063282437 10:4645131-4645153 CTGTGGGTGTGGCAGGAATTGGG - Intergenic
1068800176 10:61131757-61131779 CTGAGGGTCCCTCGGGAACTGGG - Intergenic
1069830553 10:71279884-71279906 CTGTGGCTCCTGCAGGAAGTAGG - Exonic
1070842836 10:79499826-79499848 CTGAGTGTCTGTCAAGAAGTCGG + Intergenic
1070883821 10:79872834-79872856 ATGTGGGGATCTCAGGAAGCAGG + Intergenic
1074543402 10:114384699-114384721 CTGTACCTCTCTCTGGAAGTAGG - Intronic
1075282104 10:121147953-121147975 CTGTGGTTCTCACAGGGACTAGG - Intergenic
1079383921 11:19962135-19962157 CTCTGGATCTCTCAGCCAGTAGG - Intronic
1080339324 11:31241541-31241563 CTTTGGGTCTCTAAGGGAGAAGG - Intronic
1080749373 11:35138728-35138750 CTCTGGGTTTCACAGGATGTTGG - Intergenic
1080849098 11:36052473-36052495 CAGTGGGTATCTCTGGAAGGTGG + Intronic
1080875675 11:36272156-36272178 CTGTTGATCTCAAAGGAAGTTGG - Intergenic
1081795077 11:45813161-45813183 CTGGGGATCTGTCAGGAAGGAGG + Intergenic
1081845948 11:46240439-46240461 TGGTGGGTTTCTCAGGAAGGAGG + Intergenic
1082011491 11:47452802-47452824 CCGTTGGGCTCTCAGGAAGCAGG - Intergenic
1082922610 11:58511880-58511902 CTGTTGGTCTCTAAGGACCTTGG + Intergenic
1083053948 11:59801772-59801794 GTGTGTGTGTCTCAGGAAGTAGG + Exonic
1083085328 11:60136683-60136705 CTGTGGGTATTTCTGGAAATGGG - Intergenic
1084472772 11:69372942-69372964 CTGTGGGTGTCCCAGGTAGTGGG + Intergenic
1084605499 11:70169555-70169577 CTGTGGGTCACTCAGCAGGGTGG - Intronic
1084777568 11:71387502-71387524 ATGTGGGACTGTCAGGATGTTGG - Intergenic
1084777575 11:71387535-71387557 ATGTGGGACTGTCAGGATGTCGG - Intergenic
1084777581 11:71387568-71387590 ATGTGGGACTGTCAGGATGTAGG - Intergenic
1084777588 11:71387601-71387623 GTGTGGGACTGTCAGGATGTCGG - Intergenic
1085029734 11:73263808-73263830 CTCTGGGTCACTCAGCTAGTGGG - Intergenic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1089418898 11:118316185-118316207 CTGAGGGTCTCTCAGAAAACAGG - Intergenic
1090830747 11:130419285-130419307 ATGTGGTTCTGTCAGGAAGGAGG + Exonic
1092091648 12:5808795-5808817 CTGCGGGTCTCTGAGCATGTGGG - Intronic
1092972781 12:13714093-13714115 AAGTCTGTCTCTCAGGAAGTGGG + Intronic
1095962444 12:47844139-47844161 CCTTGGGTCTCTCAGCAGGTGGG + Exonic
1096154507 12:49334494-49334516 CTGTGGGACTCTCTAGAAGAGGG - Intronic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1103300820 12:119925279-119925301 TTGTGGGCCTCCCAGGAAGGGGG + Intergenic
1103924412 12:124415624-124415646 CTCTGCGTCTCTCAGAAAGATGG - Intronic
1105602809 13:21902209-21902231 CTCTGGGTCTTTCAGGGAGATGG + Intergenic
1105990405 13:25615059-25615081 ATGGGGGTTTCTCAGGCAGTGGG + Intronic
1107633430 13:42367089-42367111 CTGTGTGTCTTTCAAGAAATTGG - Intergenic
1108173004 13:47762656-47762678 CAGTGTGGCTCTTAGGAAGTAGG + Intergenic
1109975716 13:69829019-69829041 CTTTGGGTTTCTCAGGCAATGGG - Intronic
1113292005 13:108917411-108917433 CTGGGAGTCTTTCAGGTAGTTGG - Intronic
1114083588 14:19220905-19220927 CTCTGGCTCTTGCAGGAAGTGGG - Intergenic
1116927140 14:50651109-50651131 CTCAGGATCTCTCATGAAGTTGG - Intronic
1117336766 14:54762613-54762635 CTGTGGGTCTCTCAGGAAGTAGG - Intronic
1117780148 14:59223649-59223671 CTTTGGGTCACTCAGTAAGTGGG + Intronic
1118355787 14:65012507-65012529 CTGTGGCTCTGGCAGGAGGTAGG + Intronic
1118599011 14:67458384-67458406 CTGCGGGTCTGGCAGGTAGTAGG - Intronic
1120313139 14:82857089-82857111 CTGTGTGTGTCACTGGAAGTAGG + Intergenic
1121157837 14:91703558-91703580 CAGTGCATCTCCCAGGAAGTGGG + Intronic
1123164951 14:106317778-106317800 TTCTGGTTCTCTCAGGATGTGGG + Intergenic
1125727107 15:41873760-41873782 CTGTGGGACTCTCAGGGAGGCGG - Intronic
1126903621 15:53340348-53340370 CTCAGGGCCTCTCAGGAGGTGGG - Intergenic
1128784391 15:70384070-70384092 CTGTGGGTCTCTCCCCAACTGGG + Intergenic
1130351930 15:83100389-83100411 CTGTGTGTTTCTCAGGTAATTGG + Intergenic
1130971793 15:88739516-88739538 CTGTGGGTCTAACAGGCAGTGGG + Intergenic
1131748492 15:95477943-95477965 CTGGGAGGCTCTCAGGAACTGGG - Intergenic
1132514040 16:358062-358084 GGGTGTGTCTCTCAGGAAGGTGG - Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1135323043 16:21509567-21509589 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1135739617 16:24962601-24962623 CTGTGGGACTATCAGGGATTGGG - Intronic
1136334526 16:29602753-29602775 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1136399936 16:30011607-30011629 CTGTGGGTCCCTACGGACGTGGG - Intronic
1137561527 16:49505530-49505552 CTGGGGGTCTGTCAGCAAGGGGG - Intronic
1137767983 16:50992550-50992572 CTGTGGCTCTCTCTGGAGGAAGG - Intergenic
1140152804 16:72388982-72389004 CTGTGGCTCACCCAAGAAGTTGG - Intergenic
1140596342 16:76419385-76419407 TTCTGGCTCTGTCAGGAAGTGGG - Intronic
1144075596 17:11716706-11716728 CTGCAGGGCTCTCAGGAATTTGG - Intronic
1144580908 17:16458815-16458837 CTTTGGGTCTCTCAAGACATTGG - Intronic
1145809432 17:27755696-27755718 TTGTGGGTCTCTCCGGCATTAGG + Intergenic
1147367151 17:39966454-39966476 CTGAGGGTCTCCCGGGATGTGGG + Intronic
1147841382 17:43374225-43374247 CTGGGATGCTCTCAGGAAGTGGG + Intergenic
1150660824 17:67076480-67076502 CTGTGGGTCTCTGTGTAAGGTGG - Exonic
1155038003 18:22041645-22041667 CTGTGGGTGGGTCAAGAAGTTGG - Intergenic
1155052170 18:22158045-22158067 CTGTAGGTCTCTTGGGAAGCAGG - Intergenic
1155886753 18:31217531-31217553 ATTTGGGTTTCTCAGGCAGTGGG - Intergenic
1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG + Exonic
1156619487 18:38832353-38832375 CTAAGGGTCTTTCAGAAAGTGGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158558968 18:58498135-58498157 CTCAGGGCCCCTCAGGAAGTTGG + Intronic
1158605442 18:58891708-58891730 CTGAGGATCTCTTAGAAAGTTGG + Intronic
1159367478 18:67487547-67487569 TTGTGGGCTTCTCAGCAAGTTGG + Intergenic
1159885936 18:73906945-73906967 CTGTGGGTCTCTGAGAAGATGGG - Intergenic
1160509250 18:79444057-79444079 CTCTGGGTCTGTCAGGAGGCTGG + Intronic
1160783444 19:888865-888887 CTGGGGCTCTCGCAGGAACTAGG - Intronic
1161575010 19:5050301-5050323 CTGTGGTGCTCTCAGGCAGCGGG + Intronic
1161731787 19:5965117-5965139 CAGTAGGTCTCTGAGGAGGTGGG + Intronic
1161933553 19:7357058-7357080 CTGTTGAGCTCTCATGAAGTTGG + Intronic
1163575899 19:18110551-18110573 CTGCGGTTCCCTCAGGGAGTAGG - Intronic
1164936672 19:32220238-32220260 CTGTGGATCTCCCAAGAAGCTGG - Intergenic
1164954277 19:32368208-32368230 CTGTGGGTCGGTCAGGAATTTGG + Intronic
1166075176 19:40410082-40410104 CTTTTGGCCTCTCAGGAAATGGG - Intronic
1166872012 19:45876809-45876831 CTGGGGGTCTCTCCCGGAGTCGG + Intergenic
1168393983 19:56032840-56032862 AGATGGGTCTCTCAGGAGGTAGG - Intronic
925094499 2:1185284-1185306 CTGTGGGTCTTCCAGGAACATGG + Intronic
926921115 2:17941114-17941136 CTGCGGGGCTTTCAAGAAGTTGG - Intronic
928198725 2:29232998-29233020 CAGTGGGACTCTCTGAAAGTAGG + Intronic
929951075 2:46409964-46409986 CTGTGGGTCTCTCCAGTAGCAGG - Intergenic
930232501 2:48857456-48857478 CTGGGGTCCTGTCAGGAAGTAGG - Intergenic
931140209 2:59449362-59449384 CTGTGGCTTTCTCAAGGAGTAGG + Intergenic
931799734 2:65747224-65747246 CTGTGTGTCTCTCAGGGAGGGGG + Intergenic
931921016 2:67015835-67015857 CTGTGGGGCAGACAGGAAGTGGG + Intergenic
932413926 2:71562638-71562660 CTGTGGGACTCCCAGGGAGGAGG + Intronic
935687877 2:105700297-105700319 CTGTGGAGCTCACAGGAAGGAGG - Intergenic
936528841 2:113261005-113261027 CTGTGTGTCCCTCAGAAAGGCGG - Intronic
936892956 2:117393395-117393417 CTGTGGGTGTCTCTGGAAAGAGG - Intergenic
938416117 2:131105186-131105208 GCGTGGGTCTCCCAGGAGGTCGG - Exonic
939067292 2:137498975-137498997 CTGAGTCTCCCTCAGGAAGTGGG + Intronic
943689014 2:190849986-190850008 CTGTGACTCACTCAGGCAGTTGG - Intergenic
944295681 2:198059723-198059745 GTGTGGATTTCTCAGGAAATTGG + Intronic
946043099 2:216799248-216799270 CTGTGTCTCTCTCAGGAAAGTGG + Intergenic
948476759 2:238225579-238225601 CTCTGTGTCACTCAGGAAATGGG + Intronic
948845126 2:240679500-240679522 CTGGGGGTCTCTCAGGCACCTGG - Intronic
948848734 2:240695379-240695401 CTGGGGGTCTCTCAGGCACCTGG + Intronic
1171431038 20:25083292-25083314 CTGTAGGACCCTCAGGGAGTGGG - Intergenic
1174433785 20:50490794-50490816 ATGGGGGTCTCTCATGCAGTTGG + Intergenic
1174672273 20:52319307-52319329 CTGAGGGCCTCTCAGGAAGAAGG + Intergenic
1175927718 20:62479244-62479266 CTCTGGGCCCCTCAGGAAGGAGG + Intergenic
1176033914 20:63027109-63027131 CTCTGGGTCTACCAGGAAGGTGG + Intergenic
1176112379 20:63416476-63416498 CAGTGGGGCTCTCACGAACTGGG + Intronic
1178032250 21:28541438-28541460 CTGTAGGTCTCTCATGAAATAGG - Intergenic
1179307840 21:40170891-40170913 GTGTGGTCCTCTCAGGAAGATGG + Intronic
1179560574 21:42213570-42213592 CTGTGGCTCTCTCAGGCTGGAGG - Intronic
1179988843 21:44935353-44935375 CTGTGGGTCTCCCTGAAGGTGGG + Intronic
1180010791 21:45049929-45049951 CTGTGAGCCTCTCTGGAAGCAGG - Intergenic
1180294388 22:10872362-10872384 CTCTGGCTCTTGCAGGAAGTGGG + Intergenic
1180497194 22:15901776-15901798 CTCTGGCTCTTGCAGGAAGTGGG + Intergenic
1180792409 22:18582952-18582974 CGGAGGTTCTCTCTGGAAGTTGG + Intergenic
1181229328 22:21412366-21412388 CGGAGGTTCTCTCTGGAAGTTGG - Intergenic
1181249322 22:21522497-21522519 CGGAGGTTCTCTCTGGAAGTTGG + Intergenic
1182186464 22:28408132-28408154 CTGTGCAACTCTTAGGAAGTCGG - Intronic
1183717703 22:39543553-39543575 ATCTGGGTCTCTGAGGAACTAGG - Intergenic
1185092039 22:48781070-48781092 CTGTGGGTCCCGCAGGATGGGGG - Intronic
950637284 3:14324008-14324030 CTGTGGGTCACACAGAAAGTGGG + Intergenic
951727271 3:25774332-25774354 ATTTGGGTTTCTCAGGCAGTGGG + Intronic
952031144 3:29144142-29144164 CTGGGAGTCACTCAAGAAGTGGG - Intergenic
954449619 3:50564616-50564638 CTGTGGTTCTTACAGGGAGTGGG - Intronic
954892043 3:53939618-53939640 CTGGGGGTCTGTCATGAAGATGG - Intergenic
956791121 3:72680841-72680863 CCGTGGGGCTGGCAGGAAGTGGG - Intergenic
957643279 3:82886407-82886429 TTTTGGGTAACTCAGGAAGTAGG + Intergenic
961821747 3:129578812-129578834 CTGGGGGCATCTCAGGGAGTGGG - Intronic
962423642 3:135249956-135249978 CTGTGGCTCCCTCAGGAGTTTGG + Intronic
962825544 3:139096969-139096991 CTCTGAGTCTCTGAGGAAGAGGG - Intronic
963317180 3:143772092-143772114 CTGTGCCACTCTCAGGCAGTGGG - Intronic
964862618 3:161219411-161219433 CTTTGGGTATCTCAGTAAGAGGG - Intronic
968126469 3:196163956-196163978 CTGTGGGTCCCGCAGGAGGTGGG - Intergenic
968517588 4:1021342-1021364 CTGTGGGTTTCACAGGTGGTGGG + Intronic
978317694 4:107457874-107457896 CTGTGGTTCTCTTAGAATGTAGG + Intergenic
979020377 4:115489339-115489361 ATTTGGGTTTCTCAGGCAGTGGG - Intergenic
980015320 4:127643605-127643627 CAGTTGGTGTCTCAGGAAGGAGG - Exonic
982297674 4:153846748-153846770 CTGAGGGGCTCTCATGAATTGGG - Intergenic
984337023 4:178405203-178405225 CTGTGGGTCTTTCTGGAACCTGG - Intergenic
984445431 4:179830332-179830354 TTTTGGGTCACTCAGTAAGTAGG - Intergenic
984623823 4:181982713-181982735 CTGTGGGTTTCACAGAAAGGAGG + Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
987685259 5:21190196-21190218 CTGTGGGTCTCTAAAGTATTAGG - Intergenic
987886966 5:23825369-23825391 CTGTGGGTGAGTCAGCAAGTGGG + Intergenic
989144802 5:38238197-38238219 CAGTGGGCCTCTGAGGAAGAAGG + Intergenic
991429280 5:66527320-66527342 CTATGGCTCTCTCAGGATGCTGG + Intergenic
992244320 5:74803293-74803315 CTGTGTATCTCTCAGGAATTTGG + Intronic
996615977 5:125441503-125441525 ATTTGGGTTTCTCAGGTAGTAGG - Intergenic
996919564 5:128752048-128752070 CAGTGTGTCTCTCAAGAGGTGGG - Intronic
997215831 5:132109876-132109898 CTCTGGGTCTTTGAGGAAGCAGG + Intergenic
997355524 5:133260444-133260466 CTGTGGCACGCTCAGGAAATTGG - Intronic
998008559 5:138674468-138674490 ATGTGGGTCTCTCAACAACTGGG - Intronic
999249926 5:150176489-150176511 GTGTGGGTCTCTGAGGGACTTGG + Intronic
1003192582 6:3887611-3887633 CTGTGGGTCTCTCCACAAGATGG - Intergenic
1003844480 6:10158836-10158858 CTGTGGGTCTGACAGGCACTGGG - Intronic
1005857309 6:29872409-29872431 CTGTGGGTCACACAGGCACTTGG - Intergenic
1006134393 6:31887064-31887086 CTGCTGGTCGCTCTGGAAGTTGG + Exonic
1007394752 6:41571032-41571054 CTGTGGAGTTCTCTGGAAGTGGG - Intronic
1008045903 6:46850975-46850997 CTGTGGGGTTTTCAGGATGTAGG - Intergenic
1008148064 6:47916200-47916222 CTGTGGCTCTCTCAGTAAATGGG + Intronic
1008880493 6:56376304-56376326 CTGTGGGTTTCACAGTAAGCTGG - Intronic
1013266836 6:108508317-108508339 CTGTGGGTTTTTCTGGGAGTGGG - Intronic
1018725110 6:166606211-166606233 TTGTGGGTCTCAAAAGAAGTGGG - Intronic
1018836948 6:167492320-167492342 GGGTGTGTCTCTCAGGCAGTGGG + Intergenic
1018937688 6:168284303-168284325 CTGTGGCTCTGTGAGGAAGCAGG - Intergenic
1019918356 7:4147769-4147791 CTGTCGGCTTCTCAGGAAGATGG + Intronic
1019923635 7:4178609-4178631 CTGTGGCCCTCTCTGGCAGTGGG - Intronic
1022639678 7:32170207-32170229 CTGTGGCTCTGTCAGGAGTTTGG - Intronic
1022896127 7:34751805-34751827 CTGTGGGACTCTCTGCCAGTTGG + Intronic
1024112856 7:46164097-46164119 CTGTGGGACTGTCAGGAATCTGG + Intergenic
1025727872 7:64083387-64083409 CTGTGGGGCACTGTGGAAGTGGG + Intronic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1027712583 7:81624221-81624243 GTGTGGCTCTCCCAGTAAGTAGG - Intergenic
1029639409 7:101810049-101810071 CTGTGGGAGTCTCATGATGTGGG + Intergenic
1030674971 7:112375036-112375058 ATCTGGGTCGCTCAGGAGGTCGG - Intergenic
1032566935 7:132956098-132956120 CTGAGGTTCTCTAAGGAAGAGGG + Intronic
1032585846 7:133145526-133145548 CTGTCAGCCTCCCAGGAAGTGGG + Intergenic
1033559168 7:142514781-142514803 CTGTCTGTCTCTCAGGTAGAGGG + Intergenic
1036746184 8:11411783-11411805 CTGTGGCTCTGACAGGGAGTAGG + Intronic
1038231817 8:25707623-25707645 TCCTGGGTCTCTCAGGAAGCAGG - Intergenic
1038510996 8:28135449-28135471 CTGAGTATATCTCAGGAAGTTGG + Intronic
1044319579 8:90787523-90787545 TACTAGGTCTCTCAGGAAGTCGG + Intronic
1044598194 8:93978718-93978740 CTGCTGCTCTTTCAGGAAGTGGG + Intergenic
1045026954 8:98096804-98096826 CTGTGGGTGCCTCAGGGGGTTGG - Intergenic
1047085738 8:121513430-121513452 ATGTGGGTCTTTAAAGAAGTTGG - Intergenic
1048344578 8:133567127-133567149 CTGTGGGTCTCTCAAGGTGGAGG + Intronic
1049556149 8:143283246-143283268 CAGTGGGCCTCTCAGGTAGTTGG - Intergenic
1053854287 9:42321839-42321861 CTGTGGGACTCTCAGGTTGCTGG + Intergenic
1054569935 9:66799819-66799841 CTGTGGGACTCTCAGGTTGCTGG - Intergenic
1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG + Intronic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1061155346 9:128857409-128857431 CTGTGGGTATCTCATCAGGTGGG - Intronic
1061515236 9:131085878-131085900 CTGTGGGTTCCTCACGAAATAGG + Intronic
1062086896 9:134653718-134653740 CTGGGGGTCTTTCAGGCAGGGGG + Intronic
1062287371 9:135779124-135779146 CTGTGGGACTCTCAGGGTGGAGG - Intronic
1187397098 X:18928189-18928211 CTGTGGGTCCTTGAGGGAGTGGG + Intronic
1190241920 X:48663461-48663483 CTCTGGATCTCTCATGAAGTTGG - Intergenic
1192250407 X:69408425-69408447 ATGTGGGCCTCTCAGGCAGCTGG - Intergenic
1194601298 X:95924404-95924426 ATTTGGGTTTCTCAGGCAGTGGG - Intergenic
1195581692 X:106511280-106511302 CTGTGTGTCTCTCTTGAATTGGG - Intergenic
1195831622 X:109065709-109065731 CTGGGGGTCTGTCAGAGAGTGGG + Intergenic
1197083557 X:122446595-122446617 ATTTGGGTTTCTCAGGCAGTGGG - Intergenic
1198179678 X:134194104-134194126 CTGGGGGCCTGTCAGGAGGTGGG + Intergenic
1200031258 X:153297648-153297670 CTGTAGGTCTTGCAGGAAGCAGG - Intergenic
1201010791 Y:9547159-9547181 CCGTGGGTCTTTCAAGGAGTGGG - Intergenic