ID: 1117337381

View in Genome Browser
Species Human (GRCh38)
Location 14:54766906-54766928
Sequence GGTACCAAGGGAGGACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117337381_1117337392 24 Left 1117337381 14:54766906-54766928 CCTGCATGTCCTCCCTTGGTACC 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1117337392 14:54766953-54766975 CTTGACCTCCGTGCAGCCCCAGG 0: 1
1: 0
2: 2
3: 53
4: 832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117337381 Original CRISPR GGTACCAAGGGAGGACATGC AGG (reversed) Intronic
902194869 1:14790998-14791020 GCTTCCAAGGGAGGGCAGGCTGG + Intronic
902730366 1:18365024-18365046 GGTACAATGGGAACACATGCAGG - Intronic
902781025 1:18705192-18705214 GGTCCCCAGGGAAGACATTCTGG - Intronic
902919304 1:19656895-19656917 GGTGCCCAGGGTGGACAAGCTGG + Exonic
904371430 1:30049965-30049987 GGTAGGAAGGGAGGCCAGGCTGG - Intergenic
904984388 1:34533000-34533022 GTCACCATGTGAGGACATGCAGG + Intergenic
907325896 1:53638511-53638533 GGGAACAAGGGAGGACAGACTGG - Intronic
907871329 1:58446057-58446079 GGTAACCAGGGAAGCCATGCTGG - Intronic
914003830 1:143715910-143715932 GGTACAACAGGAGGACATGGTGG - Intergenic
916146596 1:161745607-161745629 TGTACTAAGGGAGCACATGGAGG - Intergenic
916809566 1:168293479-168293501 GGCACCAGGAGAGCACATGCTGG - Intronic
918005904 1:180542107-180542129 GATAGCAAGGGAGGCCATGAGGG + Intergenic
918287913 1:183076608-183076630 GCTACAAAGGTAGGATATGCTGG - Intronic
922569478 1:226625552-226625574 GGGAGCATGGGAGGACAGGCAGG - Intergenic
924209733 1:241752407-241752429 TTTACCAAGTGAGGACATGAGGG - Intronic
1063964200 10:11333191-11333213 GTCACCAAGAGAGGACATGAGGG + Exonic
1066646551 10:37616524-37616546 GGAACCCAGGGAGGAAATGAAGG - Intergenic
1068952711 10:62793006-62793028 GGAAACAAGGGAGGAAAAGCAGG + Intergenic
1069696705 10:70391849-70391871 TGTACCAAGAGAGGGCATGCAGG + Intergenic
1070070911 10:73088410-73088432 AGTACCAAGGGAGGGAATACTGG - Intronic
1074424160 10:113336407-113336429 GATACCAAGGAAGGACAGGTGGG - Intergenic
1074523994 10:114248944-114248966 GGGACCCAGGGAGGCCAGGCAGG - Intronic
1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG + Intergenic
1075650121 10:124122295-124122317 AATACCAAGTGAGCACATGCAGG - Intergenic
1076188901 10:128469317-128469339 TGCACCAAGGGAGGACAGGTGGG - Intergenic
1076782428 10:132731606-132731628 GGGACCAAGGAAGGGCACGCAGG + Intronic
1079939669 11:26663695-26663717 GCTAAGGAGGGAGGACATGCAGG + Intergenic
1080308144 11:30858884-30858906 GGTACCTGGGGAAGACAGGCAGG - Intronic
1081594071 11:44447095-44447117 GGAAGCAAAGGAGGACATGCGGG + Intergenic
1087840298 11:102913799-102913821 GGTATCAAGGGAGAATATCCAGG + Intergenic
1090101133 11:123797930-123797952 GGCACCAAGCAAGGACATTCAGG + Intergenic
1091204401 11:133809870-133809892 GGTACTATGGGATGACAGGCGGG - Intergenic
1092125412 12:6071902-6071924 GGGACCAAGGGAGGGCAGACTGG + Intronic
1096880152 12:54660746-54660768 GCTACCAAGGGACAACAGGCAGG - Intergenic
1098291271 12:68958819-68958841 GTTACCAAGGGATGAGAGGCAGG - Intronic
1098444974 12:70557179-70557201 GGTACCAAAGGAGGAGGTGCCGG + Intronic
1098880185 12:75909394-75909416 GGGACAAAGGGAGGAAAGGCTGG - Intergenic
1101604212 12:106235488-106235510 GGTCCAGAGAGAGGACATGCAGG + Intergenic
1103124206 12:118407406-118407428 GGGACCAATGGTGGACATTCAGG + Intronic
1103247846 12:119473278-119473300 GGCAGCCAGGGAGGAAATGCAGG + Intronic
1104771396 12:131366841-131366863 GGGTCCCAGGGAGGCCATGCGGG + Intergenic
1108331159 13:49385920-49385942 GATACAAAGTGAGCACATGCTGG + Intronic
1113079308 13:106500719-106500741 GCTAGCATGTGAGGACATGCTGG - Intronic
1113533085 13:111043583-111043605 GGGACCAAGGGAGGCCACGCAGG - Intergenic
1114735421 14:25038849-25038871 GTTACCAGGGGAGGAGATGGAGG + Intronic
1117337381 14:54766906-54766928 GGTACCAAGGGAGGACATGCAGG - Intronic
1120916311 14:89713553-89713575 GGTACAAGTGCAGGACATGCAGG + Intergenic
1123623520 15:22211523-22211545 GGTACGTGTGGAGGACATGCAGG - Intergenic
1125519098 15:40338416-40338438 GTGGCCAAGGGAGCACATGCAGG - Intronic
1128698715 15:69788392-69788414 GGTACCAATGGAGGCCTTTCAGG - Intergenic
1128751002 15:70148874-70148896 GGAACCAAGGGAGAAAATGGAGG + Intergenic
1128756306 15:70186161-70186183 GGTGCCCAGGGAGGGCGTGCTGG + Intergenic
1129452906 15:75660778-75660800 GGGACCCTGGGAGGTCATGCAGG - Exonic
1129797251 15:78387196-78387218 GGTATCAAGGGGAGACAAGCTGG + Intergenic
1130701185 15:86183974-86183996 GCTACCAAGAGATGACAGGCAGG - Intronic
1130719468 15:86372450-86372472 GACACCAAGGGAGGAAATGATGG - Intronic
1132315011 15:100883333-100883355 GTTACCAAGTGATGACTTGCTGG + Intronic
1133149074 16:3812953-3812975 GTTACCCAGAGTGGACATGCTGG - Intronic
1134017413 16:10898768-10898790 GGGAACAAGGCAGGAAATGCAGG - Intronic
1137379055 16:47981040-47981062 GATTCCAAGGGAGGCCATGATGG - Intergenic
1137974967 16:53023505-53023527 GGCACCATGGGAGGACAGGCTGG + Intergenic
1139687118 16:68612695-68612717 GGTACCTGGGGAAGACATGCTGG - Intergenic
1140882961 16:79215515-79215537 AGAACCAAGAGAGGACATGCTGG + Intergenic
1145931035 17:28685867-28685889 GCCACAAAAGGAGGACATGCAGG + Intronic
1146258803 17:31408077-31408099 GGTAACAAGGTATGACAGGCTGG - Intronic
1147587859 17:41662946-41662968 GGTTCCAAGAGAGGCCCTGCTGG + Intergenic
1147980790 17:44272792-44272814 GGTCCCCAGGGAGACCATGCTGG + Intergenic
1150290035 17:63975779-63975801 GGTACCCAGGGAGGGCTTCCTGG - Intergenic
1151212941 17:72558464-72558486 GTTACCTAGGGAGGACTTGAGGG + Intergenic
1152572250 17:81126005-81126027 GGGACCCCGGGGGGACATGCTGG - Intronic
1157965863 18:52207387-52207409 CGTACCATGTGAGGACAGGCTGG - Intergenic
1157977135 18:52340254-52340276 GGGACCCAGGGAGGAGAGGCGGG - Exonic
1159069759 18:63610654-63610676 GGTACCAAGGGAGGAACCTCAGG + Intergenic
1159392103 18:67806556-67806578 GATACCTATGGAGAACATGCAGG - Intergenic
1163723031 19:18907260-18907282 GGAACGGAGGGAGGACATGTCGG - Intronic
1165567751 19:36746181-36746203 GATACAAAGTGAGCACATGCTGG - Exonic
1167498359 19:49831855-49831877 GCTACCAGGGTAGGACATGAGGG + Intronic
1168064235 19:53910019-53910041 GGTCCCAAAGGAGGAAAGGCTGG + Intronic
1168133180 19:54333825-54333847 GGTACCCTGGGTGGACATCCAGG - Intronic
925298488 2:2793499-2793521 GGGACTGAGGGAGGAGATGCTGG - Intergenic
925423915 2:3733338-3733360 GGTACAAATGCAGGACATACTGG - Intronic
925746834 2:7050835-7050857 GCTCCCAAGGGAGGAAGTGCTGG + Intronic
929593687 2:43162572-43162594 GGTACCAAGGATGGAGATGATGG - Intergenic
931691521 2:64838269-64838291 GGTACCCAGGGATGCCATCCTGG + Intergenic
933975023 2:87502484-87502506 GAAACCAAGGGAGGACGTCCTGG + Intergenic
935187038 2:100743898-100743920 GGTACCCAGGGAGGATGTGAAGG + Intergenic
935332405 2:101986600-101986622 GCTAGCACAGGAGGACATGCAGG + Intergenic
936242729 2:110801698-110801720 GATACCCAGGGAGAACCTGCTGG + Exonic
936318803 2:111448330-111448352 GAAACCAAGGGAGGACGTCCTGG - Intergenic
940239800 2:151550535-151550557 GGCAGAAAGGGAGGACATGGAGG + Intronic
941085777 2:161115870-161115892 GGTGCAAAGGCAGGGCATGCTGG - Intergenic
943767343 2:191677630-191677652 GGTACCAAGGGAAAACAGGCTGG - Intergenic
945176418 2:207048150-207048172 TGTACCCAGGGAGGACAGGCTGG + Intergenic
945750043 2:213770482-213770504 GGTACATATGCAGGACATGCAGG + Intronic
948068148 2:235097478-235097500 GGCACCTAGGGAGAACATGCTGG + Intergenic
1170694764 20:18648167-18648189 GATACCATGGGAGGCCTTGCTGG + Intronic
1171427943 20:25060118-25060140 GGTTCCATGGGAGGATAAGCTGG - Intergenic
1172097500 20:32467547-32467569 GGGACCAAGGGAGACCAGGCTGG + Intronic
1174423648 20:50416827-50416849 TGCACTAATGGAGGACATGCGGG - Intergenic
1178512551 21:33217942-33217964 GGAACCAAAGGAGGCCTTGCGGG - Intergenic
1179178684 21:39027088-39027110 GGCTCCAAAGGTGGACATGCTGG - Intergenic
1179245614 21:39631812-39631834 GGTACCAAGAAAGGGGATGCTGG + Intronic
1181553781 22:23655920-23655942 GTTACTAAGGGAGGGCAGGCAGG + Intergenic
1182147145 22:28003502-28003524 GGAGCCCAGGGAGGACCTGCAGG - Intronic
1182633211 22:31703692-31703714 GGTACCAAGGCAGGGAATGGAGG + Exonic
1185121513 22:48974478-48974500 GGAAGCCAGGGAGGACATGTGGG + Intergenic
949510567 3:4763323-4763345 GGTACCTATGCAGGACGTGCAGG - Intronic
950231165 3:11277126-11277148 GGGAGCAAGGGAGGAAATGGAGG - Intronic
950239059 3:11351529-11351551 GGGAGCAAGGGACGCCATGCTGG + Intronic
950678203 3:14567374-14567396 GGTCCCCAGGGAGGGCATGAGGG - Intergenic
951162419 3:19441011-19441033 GGAACCAAGGGAAGACTGGCAGG + Intronic
951706075 3:25545661-25545683 GCTACCCAGGGAGGAGCTGCAGG - Intronic
952336417 3:32407071-32407093 GGCACCAAGGGAGTCCCTGCTGG + Intronic
953184828 3:40628206-40628228 TGTGCCTAGGGAGGACCTGCGGG + Intergenic
954226983 3:49188458-49188480 GGAACCCTGGGAGGACATGGAGG + Intronic
957132458 3:76240164-76240186 GGTACCTATGCAGAACATGCAGG + Intronic
957205092 3:77186454-77186476 GGAATCAAGGGAGAGCATGCAGG + Intronic
960195043 3:114755316-114755338 TGAACCAAGGGAGGACATAAGGG + Intronic
961822871 3:129584248-129584270 GGAGCCAGGGGAGGACATGGGGG + Intronic
962089358 3:132227049-132227071 GATACCTATGCAGGACATGCAGG + Intronic
962436638 3:135373173-135373195 GGTACTGAGGGAGCACATGGTGG - Intergenic
965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG + Intergenic
966729780 3:183141060-183141082 GATACCATGGGAGGACCTCCCGG + Intronic
969868923 4:10092937-10092959 GGCTGCAAGGGAGGACAGGCAGG - Intronic
980239321 4:130153004-130153026 GGTACCTGTGCAGGACATGCAGG + Intergenic
982315001 4:154023260-154023282 GGTATCATGTGAGGATATGCAGG + Intergenic
982375932 4:154690532-154690554 GGCAGCAAGGGAGGAAATGGAGG - Intronic
986041369 5:3997063-3997085 CGTCCCAAGGGAGGACAGGGAGG + Intergenic
986672509 5:10155291-10155313 GATACCCATGGAGGCCATGCTGG + Intergenic
990628362 5:57640208-57640230 GGAACTTAGGGAGGAAATGCTGG + Intergenic
992444160 5:76819440-76819462 GGCACCCAGGTGGGACATGCGGG + Intronic
994058708 5:95449221-95449243 GGTGCCTTGGGAGGACATGAGGG + Intronic
994772940 5:104006749-104006771 GGTACTACGGGAGGATATACTGG - Intergenic
999090505 5:148931928-148931950 GGAAGCAAGGGAGGAAATGAGGG - Intronic
1004512715 6:16295698-16295720 GGGGCCAAGGGTGGACAGGCCGG + Intergenic
1005849706 6:29812496-29812518 GGCACAAAGAGAGAACATGCTGG + Intergenic
1005988518 6:30889314-30889336 GGCACCCAGGGACGGCATGCCGG + Exonic
1007677509 6:43609100-43609122 GGTAACTAGGGAGGACCTCCTGG - Intronic
1011697872 6:89929381-89929403 GATTCAAAGGGAGGACTTGCTGG - Exonic
1012910820 6:105115681-105115703 CTTACGAAGAGAGGACATGCTGG + Exonic
1017042027 6:150315458-150315480 GGCACAAGGGGAGGACATGAAGG + Intergenic
1018457024 6:163961960-163961982 GTTACCAGGGGAGCACATGGCGG + Intergenic
1019432806 7:1007283-1007305 GGGACTCAGGAAGGACATGCTGG - Intronic
1020276978 7:6630519-6630541 GATACCAAGGGTGGAGATTCTGG - Intergenic
1022794934 7:33724495-33724517 GGGACTCAGTGAGGACATGCAGG + Intergenic
1024365547 7:48516355-48516377 GGTCCAAAGTGAGGATATGCAGG - Intronic
1025247486 7:57328264-57328286 TGCACAAATGGAGGACATGCAGG + Intergenic
1030319937 7:108155561-108155583 GGTACCAAGGGAACAGAAGCAGG - Intronic
1033547387 7:142413762-142413784 GGTAACAAGCCAAGACATGCTGG - Intergenic
1033662874 7:143414692-143414714 TGGAAGAAGGGAGGACATGCAGG - Intergenic
1035754074 8:2018040-2018062 GGTAGCCAGGTAGTACATGCCGG - Intergenic
1036636860 8:10557081-10557103 TGTAGCAAGAGAGGACATGCTGG + Intergenic
1037680741 8:21095503-21095525 GGCACCAAGGAAGGAGTTGCCGG - Intergenic
1037742764 8:21620544-21620566 GGGACCAAGAGAGGATATCCAGG + Intergenic
1039116834 8:34100685-34100707 GGTCCCGAGAGAGGACATGTTGG - Intergenic
1039901234 8:41753917-41753939 TGAAGCAAGGGAGAACATGCCGG - Intronic
1040490729 8:47919573-47919595 GGAACCAAGAGAAGACTTGCTGG - Intronic
1048165077 8:132055140-132055162 GGGACCAAGAAAGGACATGGGGG - Intronic
1048177181 8:132163371-132163393 GGCCCCATGGGAGGTCATGCTGG - Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1055330239 9:75176357-75176379 TGTACCAAACCAGGACATGCAGG + Intergenic
1062582550 9:137234926-137234948 GGTCTCAAGGGAGGAGACGCAGG - Intronic
1062710995 9:137975156-137975178 AGTACTGAGGGAGGCCATGCTGG - Intronic
1189784038 X:44543213-44543235 GGTACAAAGGGAGAACCAGCTGG + Intergenic
1190488663 X:50957892-50957914 GGTACATAGGCAGAACATGCAGG - Intergenic
1190571453 X:51786677-51786699 GGTACCAAGGGAGGCTAAGTGGG - Intergenic
1190799911 X:53778272-53778294 AGTGACAAGGGAGGAAATGCAGG - Intergenic
1193083195 X:77425548-77425570 GGTACAAAGTGAGGACATGTAGG + Intergenic
1200071033 X:153529467-153529489 GGCACCACGGGAGGCCATTCAGG + Intronic
1200973763 Y:9184516-9184538 GGTACACATGCAGGACATGCAGG - Intergenic
1200975249 Y:9205493-9205515 GGTACATATGCAGGACATGCTGG + Intergenic
1202137353 Y:21680278-21680300 GGTACATATGCAGGACATGCAGG + Intergenic