ID: 1117338623

View in Genome Browser
Species Human (GRCh38)
Location 14:54775524-54775546
Sequence AGCTCTGGTGGAGCATCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 294}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117338615_1117338623 18 Left 1117338615 14:54775483-54775505 CCCTTTTTATCCATGGCAAAAAG 0: 1
1: 0
2: 1
3: 31
4: 378
Right 1117338623 14:54775524-54775546 AGCTCTGGTGGAGCATCCACAGG 0: 1
1: 0
2: 3
3: 31
4: 294
1117338618_1117338623 -7 Left 1117338618 14:54775508-54775530 CCTTTGTCTCAGTCCCAGCTCTG 0: 1
1: 0
2: 3
3: 59
4: 930
Right 1117338623 14:54775524-54775546 AGCTCTGGTGGAGCATCCACAGG 0: 1
1: 0
2: 3
3: 31
4: 294
1117338617_1117338623 8 Left 1117338617 14:54775493-54775515 CCATGGCAAAAAGCTCCTTTGTC 0: 1
1: 0
2: 1
3: 18
4: 146
Right 1117338623 14:54775524-54775546 AGCTCTGGTGGAGCATCCACAGG 0: 1
1: 0
2: 3
3: 31
4: 294
1117338616_1117338623 17 Left 1117338616 14:54775484-54775506 CCTTTTTATCCATGGCAAAAAGC 0: 1
1: 0
2: 1
3: 20
4: 226
Right 1117338623 14:54775524-54775546 AGCTCTGGTGGAGCATCCACAGG 0: 1
1: 0
2: 3
3: 31
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117338623 Original CRISPR AGCTCTGGTGGAGCATCCAC AGG Intronic
900753534 1:4416803-4416825 AGCCACGGTGGAGCATCCATTGG + Intergenic
901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG + Intergenic
902677542 1:18019232-18019254 AACTCTGGTGGACCATCATCAGG - Intergenic
906238528 1:44227177-44227199 AGGTCTGCTGGAGTCTCCACAGG + Intronic
907438624 1:54464953-54464975 AGCTCTGGCAGAGCAGTCACAGG + Intergenic
907759433 1:57343389-57343411 GGCCCTGGTGCAGGATCCACTGG - Intronic
908068791 1:60435594-60435616 TGCTCTGGTGCAGGATCAACTGG + Intergenic
909759313 1:79269541-79269563 AGCCCCGGTGCAGGATCCACTGG + Intergenic
910034692 1:82776721-82776743 AGCCCTGGTGCGGGATCCACTGG - Intergenic
910513615 1:88035382-88035404 TGCTGTGGTGGAGCCTCCCCTGG - Intergenic
910936928 1:92491841-92491863 AGCTGAGGTGGAACATCCAGTGG - Intergenic
911180500 1:94856032-94856054 AGCTCTGCTGGTAAATCCACTGG - Intronic
912235435 1:107845125-107845147 TGCTCTTCTGCAGCATCCACTGG + Intronic
912316003 1:108667897-108667919 AGCTCTGGTGCAGGATCCACTGG + Intergenic
912685231 1:111756682-111756704 AGCTATGGTGGAGAACACACAGG - Exonic
913470258 1:119179445-119179467 GGCCCTGGTGCAGGATCCACTGG + Intergenic
914438360 1:147680705-147680727 AGCCCTGGTGCGGGATCCACTGG - Intergenic
915104198 1:153522198-153522220 AGCCCTGGTGCAGGATCCACTGG + Intergenic
915865474 1:159494547-159494569 AGCCCTGGTGCGGGATCCACTGG - Intergenic
916605875 1:166342799-166342821 GGCCCTGGTGCAGGATCCACTGG - Intergenic
916939101 1:169661594-169661616 AGCCCTGGTGTGGGATCCACTGG + Intergenic
917704909 1:177622722-177622744 AACTCTGGTGGGGAATCCACAGG - Intergenic
919091982 1:192987330-192987352 AGCCCTGGTGTGGGATCCACTGG + Intergenic
919201276 1:194358208-194358230 AGCCCTGGTGTGGCATCCACTGG - Intergenic
921096336 1:211889831-211889853 GGCTCTGGTGCAAGATCCACTGG + Intergenic
922985954 1:229865877-229865899 AGCCCTGGTGCGGGATCCACTGG + Intergenic
923573895 1:235140715-235140737 AGCCCCGGTGCAGGATCCACTGG + Intronic
1062787608 10:278383-278405 AGCCCTCCTGGAGCCTCCACCGG - Intronic
1063769775 10:9183771-9183793 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1065752100 10:28896759-28896781 AGCTCCGGTGCGGGATCCACTGG - Intergenic
1065995585 10:31056241-31056263 GGCCCTGGTGCAGGATCCACTGG + Intergenic
1067363271 10:45601162-45601184 AGCCCTGGTGTGGGATCCACTGG + Intergenic
1068374100 10:56155545-56155567 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1068792348 10:61041035-61041057 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1069297593 10:66866357-66866379 AGCTCTAGTGGAGGATGCAAAGG - Intronic
1070820387 10:79350777-79350799 AGCCCAGCTGAAGCATCCACAGG - Intronic
1070879541 10:79845335-79845357 AGCGGTGGTGGAGCCTGCACAGG + Intronic
1071055762 10:81506194-81506216 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1071632649 10:87229425-87229447 AGCGGTGGTGGAGCCTGCACAGG + Intronic
1071646097 10:87361643-87361665 AGCGGTGGTGGAGCCTGCACAGG + Intronic
1071797010 10:89018593-89018615 AGCCCCGGTGCAGGATCCACGGG - Intergenic
1076704497 10:132293818-132293840 AGCTCTGGTAGGGCTTCCTCGGG - Intronic
1077603305 11:3589101-3589123 AGCTCTTGTGCGGGATCCACTGG + Intergenic
1081420975 11:42874334-42874356 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1082698683 11:56401859-56401881 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1083146866 11:60766526-60766548 AGCTGTGGTGGTCTATCCACAGG + Intronic
1083289912 11:61684061-61684083 AGCTCTGGTCCAGCATCCTCTGG - Intronic
1083546186 11:63550625-63550647 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1084210542 11:67619458-67619480 AGCACCGGTGCAGGATCCACTGG + Intergenic
1084259200 11:67963644-67963666 AGCTCCTGTGCAGAATCCACTGG + Intergenic
1085960393 11:81455046-81455068 AGCTATGTTGGTGAATCCACTGG - Intergenic
1086320959 11:85647267-85647289 AGACCTGGTGAGGCATCCACTGG + Intergenic
1086808096 11:91269177-91269199 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1088833404 11:113557207-113557229 TGCTCTGCTGGAGCAGTCACGGG - Intergenic
1089113311 11:116073919-116073941 AACTCTTGGGGAGCAGCCACGGG + Intergenic
1092142030 12:6190810-6190832 AGCGCTGGTGCGGGATCCACTGG - Intergenic
1092732533 12:11547669-11547691 AGCCCCGGTGGGGGATCCACTGG + Intergenic
1092834147 12:12472373-12472395 AGCTCTGGTGCAGGATCCACTGG - Intergenic
1093189481 12:16057796-16057818 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1093973032 12:25391850-25391872 AGCCCTGGTGCAGGATTCACTGG + Intergenic
1094409914 12:30157281-30157303 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1095123167 12:38442370-38442392 AGCCCTGGTGTGGGATCCACTGG + Intergenic
1095478572 12:42610886-42610908 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1095954593 12:47798876-47798898 GGCTCTGGTGGGGGCTCCACTGG + Exonic
1096459965 12:51816725-51816747 TGCCCTGGTGGAGGATGCACAGG - Intergenic
1097046971 12:56194334-56194356 AGCTTTGGTGGAAATTCCACAGG - Intergenic
1098079261 12:66766505-66766527 AGCTCTTGGGGAGCAGACACTGG + Intronic
1102387177 12:112519871-112519893 AGCCCTGGTGCAGGATCTACTGG - Intergenic
1103146070 12:118597115-118597137 AGCCCTGGTGCGGGATCCACCGG - Intergenic
1104016393 12:124965087-124965109 AGCTCTGGTGGAGCAGCCTGGGG - Intronic
1104112240 12:125714991-125715013 AGCTCAGATGAAACATCCACTGG - Intergenic
1105876609 13:24560645-24560667 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1106600483 13:31182991-31183013 AGCCCTGGTGAGGGATCCACTGG - Intergenic
1106643356 13:31608768-31608790 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1107027978 13:35823067-35823089 AGCTCTGGGGGAGATGCCACTGG - Intronic
1107590387 13:41898518-41898540 AGCCCTGGTGCGGGATCCACTGG - Intronic
1108469382 13:50753246-50753268 AGCCCTGGTGCGGGATCCACTGG - Intronic
1109563093 13:64077474-64077496 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1110023995 13:70511850-70511872 AGCTCTGGTGCGGGATCCACTGG - Intergenic
1110751324 13:79119576-79119598 GGCCCCGGTGGAGGATCCACTGG - Intergenic
1112518720 13:100077937-100077959 AGCCCTGGTGTGGGATCCACTGG + Intergenic
1112842762 13:103600360-103600382 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1113482609 13:110632968-110632990 AGCCCTGGTGCGGGATCCACTGG - Intronic
1116223117 14:42113432-42113454 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1117077944 14:52122666-52122688 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1117280949 14:54240345-54240367 AGTTCTGCTTGAGCATCCATTGG - Intergenic
1117338623 14:54775524-54775546 AGCTCTGGTGGAGCATCCACAGG + Intronic
1117449886 14:55839888-55839910 AGCCCTGGTGTGGGATCCACTGG + Intergenic
1121891278 14:97593506-97593528 AGAGCTGGTGGTGCATCCTCAGG - Intergenic
1122460705 14:101892272-101892294 AGCTCTCATCCAGCATCCACTGG + Intronic
1122588087 14:102825209-102825231 AGCTTTGCTGGAGCACCCACTGG + Intronic
1123399392 15:19969435-19969457 ACCTCTCATGGGGCATCCACAGG - Intergenic
1124114775 15:26831118-26831140 AGCCCTGGTGCGGGATCCACTGG - Intronic
1125717139 15:41825796-41825818 CCCTGTGGTGGAGCATACACAGG + Exonic
1127765991 15:62186503-62186525 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1127984859 15:64061307-64061329 GGCCCTGGTGGGGGATCCACTGG + Intronic
1128669909 15:69567297-69567319 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1128813232 15:70587113-70587135 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1129373939 15:75115935-75115957 AGCCCCGGTGCAGGATCCACTGG - Intronic
1129845927 15:78767714-78767736 AGCTCTGGAGAATCAACCACTGG - Intronic
1129986966 15:79926496-79926518 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1130255946 15:82326149-82326171 AGCTCTGGAGAATCATCCACTGG + Intergenic
1130545666 15:84856440-84856462 AGCTCTGATGTAGCCTCCATTGG + Exonic
1130599009 15:85263837-85263859 AGCTCTGGAGAATCATCCACTGG - Intergenic
1130713915 15:86312814-86312836 AGCTCTGTTGAAGCATCCTGGGG - Intronic
1130933288 15:88448120-88448142 AGCTCTGGCCCAGCACCCACTGG - Intergenic
1131893804 15:97004071-97004093 GGCTCTGATGGAGCAAGCACAGG + Intergenic
1132602613 16:780339-780361 GTGTCTGGTGGAGCATGCACAGG + Intronic
1132679799 16:1135065-1135087 AGCTGTGGTGGAGAATCGATTGG - Intergenic
1133226960 16:4345516-4345538 AGCTCTGGAGTCGAATCCACTGG - Intronic
1135222571 16:20625470-20625492 CGCTTTGGTGGAGCACCCAGCGG - Exonic
1135826056 16:25729913-25729935 TGCTCTGGTGGCTCATACACAGG + Intronic
1135942625 16:26836038-26836060 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1139125465 16:64072267-64072289 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1139600358 16:67982644-67982666 GGCCCCGGTGCAGCATCCACTGG + Intergenic
1142094959 16:88234570-88234592 ACCCCTGGTGGATGATCCACAGG - Intergenic
1142472877 17:172882-172904 AGCTCAGGTGGACCACACACTGG - Intronic
1144642967 17:16948830-16948852 AGCTCTGGTGGAAGGTTCACTGG + Exonic
1144754832 17:17673078-17673100 AGCTTTGCTGGAGCCTCCAGGGG - Intergenic
1144947769 17:18978507-18978529 AGCGCTGGCTGAGCATCCAGGGG - Exonic
1146740384 17:35278852-35278874 TGCCCTGGTGGGGGATCCACTGG - Intergenic
1147373698 17:40011356-40011378 AGCCCTGGTGCGGAATCCACTGG + Intergenic
1147431889 17:40376251-40376273 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1147986922 17:44312144-44312166 AGCTCAGGTGGGGCACACACTGG + Intronic
1148016950 17:44528395-44528417 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1148154272 17:45413715-45413737 AGCTGGGGTGGGGCATCCTCAGG + Intronic
1148205527 17:45777427-45777449 AGCCATGGTGGAGCATCAGCTGG - Intergenic
1148208635 17:45794900-45794922 GGCTCTGGTGGAGCCTCAGCTGG + Intronic
1149099186 17:52883914-52883936 GGCCCTGGTGCGGCATCCACTGG - Intronic
1149313151 17:55415687-55415709 AGTTCAGGTGGAAAATCCACTGG + Intronic
1150778355 17:68099702-68099724 AGCCCCGGTGGGGGATCCACTGG + Intergenic
1151431095 17:74063737-74063759 AGATATGGTGGCGCCTCCACAGG - Intergenic
1151683447 17:75633761-75633783 GGCTCAGGTGGAGCCTCCCCAGG + Intronic
1152937638 17:83149804-83149826 GGCCCTGGTGGAGGATGCACTGG - Intergenic
1154315254 18:13298924-13298946 AATTCTGGGGGAGCATCCACAGG + Intronic
1157560583 18:48642858-48642880 AGCTCTGGAGGATCATGCATTGG + Intronic
1157979725 18:52366842-52366864 AGCCCTGGTGCGGGATCCACTGG - Intronic
1158241474 18:55383515-55383537 AGCTCTATTTGAGCATCTACTGG - Intronic
1158351998 18:56572712-56572734 AGCCCTGGTGTGGGATCCACTGG + Intergenic
1158460663 18:57643598-57643620 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1159472870 18:68879934-68879956 AGCCCTGGTGCGGGATCCACTGG - Intronic
1162107073 19:8376186-8376208 AGCCCCGGTGCAGGATCCACTGG + Intronic
1162230220 19:9259935-9259957 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1162267149 19:9584762-9584784 AGCTCTGCAGGAGCATCCCCTGG - Intergenic
1162271775 19:9621566-9621588 AGCTTTGGAGGAGCATCCCCCGG - Exonic
1162278299 19:9675407-9675429 AGCTTTGGAGGAGCATCCTCTGG - Intergenic
1162281495 19:9701375-9701397 AGCTTTGGAGGAGCATTCCCTGG - Intergenic
1162632628 19:11941234-11941256 AGCCCTGGTGCAGGATCCACTGG - Intronic
1164170242 19:22718599-22718621 AGCCCTGGTCCAGCACCCACGGG - Intergenic
1165846655 19:38821889-38821911 GGCCCTGGTGCAGGATCCACTGG + Intronic
1165912556 19:39238065-39238087 AGCTCAGGAGGAGGAGCCACGGG + Intergenic
1166740723 19:45113333-45113355 AGCGTTGGTGGAACACCCACTGG + Intronic
1167867887 19:52343052-52343074 ATCTCTGCTGGGGCATCCACAGG + Intronic
1167874608 19:52401189-52401211 ATCTCTGCTGGGACATCCACAGG + Intronic
1168339766 19:55616201-55616223 AGCGCTGGTGGCGCATCAGCAGG - Exonic
925088618 2:1134664-1134686 AGCCCCGGTGGGGGATCCACTGG - Intronic
925168497 2:1735493-1735515 AGCTCTGATGGAGAATGCAAGGG - Intronic
925265336 2:2562999-2563021 AGCTCTTGGGGAGCCTCCACGGG + Intergenic
926097564 2:10091839-10091861 AGCCCTGGTGCGACATCCACTGG + Intergenic
926164105 2:10507420-10507442 AGCCCTGCTGGAGCCTCCAGGGG + Intergenic
927900479 2:26814781-26814803 AGCCCTGGTGCGGGATCCACTGG + Intergenic
928945386 2:36767350-36767372 AGCTCTGTCTGAGCATCTACTGG + Intronic
929379763 2:41336012-41336034 AGCCCTGGTGCGGGATCCACTGG + Intergenic
930038089 2:47100154-47100176 AGCCCTGGTGTGGGATCCACTGG + Intronic
930039289 2:47107701-47107723 AGCCCTGGTGCGGGATCCACTGG + Intronic
930468156 2:51780274-51780296 AGCCCCGGTGCAGGATCCACTGG - Intergenic
930527289 2:52545762-52545784 AGCTCTTGTCCAGCATCCAGGGG - Intergenic
934878532 2:97951310-97951332 AGCTCTGCTGGAGCTCCCACTGG + Intronic
936021560 2:108998895-108998917 GGCTCTGGTGGAGGAGGCACGGG - Intergenic
936346964 2:111682272-111682294 AGCCCCGGTGCAGGATCCACTGG + Intergenic
937422337 2:121768548-121768570 AGCTCTGGTGGTGTTCCCACAGG - Intergenic
938126005 2:128672061-128672083 AGCCCCGGTGCAGGATCCACTGG - Intergenic
939869128 2:147507351-147507373 AGCTGTGGTGCAGGATCCACTGG + Intergenic
939972475 2:148678339-148678361 AGCCCTGGTGCGGGATCCACTGG - Intronic
941309859 2:163914039-163914061 AGCCCTGGTGCGGGATCCACTGG + Intergenic
942248107 2:174025773-174025795 CGCGCTGGTGGGGCCTCCACAGG - Intergenic
943024285 2:182608818-182608840 CGCTCTGGTGCGGGATCCACTGG + Intergenic
945012132 2:205476503-205476525 AGTTCTGGTGCTGTATCCACTGG + Intronic
946923490 2:224603640-224603662 AGCCCTGGTGCGGAATCCACTGG - Intergenic
947026708 2:225744555-225744577 AGCCCTGGTGCGGGATCCACTGG + Intergenic
947412063 2:229851138-229851160 AGCCCCGGTGCAGGATCCACTGG + Intronic
1169210119 20:3761244-3761266 CCCTCTGGTTTAGCATCCACTGG - Intronic
1174421066 20:50399471-50399493 AGCTCTGCTGGAGCGCCCACTGG + Intergenic
1176081020 20:63273040-63273062 AGCTCTGGGGCAGCAGCCTCAGG - Intronic
1176663293 21:9660423-9660445 GGCCCTGGTGCAGGATCCACTGG + Intergenic
1178633363 21:34281446-34281468 AGCTCTGGTAGAAAATTCACTGG - Intergenic
1179248144 21:39650691-39650713 GGCTCTGGTGGAACGTCCACAGG + Intronic
1179522730 21:41955617-41955639 CCCTCTGATGGACCATCCACTGG - Intergenic
1183095129 22:35547401-35547423 AGCTCTGGTGGGTCATCTTCCGG - Intronic
1183530473 22:38350771-38350793 AACACGGGTGGAGCCTCCACAGG + Intronic
1185217676 22:49611372-49611394 AGCTCTAGGCAAGCATCCACTGG + Intronic
951332883 3:21387190-21387212 AGCCCCGGTGTGGCATCCACTGG - Intergenic
953388341 3:42519918-42519940 AGCTCTGGGAGAGCAGCCCCGGG - Intronic
953423097 3:42770086-42770108 GGCCCTGGTGCAGGATCCACTGG + Intronic
954762919 3:52890060-52890082 TGCTCAGGTGGAGCTTCCTCAGG + Intronic
955824903 3:62935361-62935383 AGGTCTGCTGGTGCTTCCACTGG - Intergenic
955950601 3:64239026-64239048 AGCCCTGCTGGTGCATCCTCAGG + Intronic
956195814 3:66651949-66651971 AGCCCCGGTGCAGGATCCACTGG + Intergenic
956563701 3:70612235-70612257 AGCCCTGGTGCAAGATCCACTGG + Intergenic
957919605 3:86731449-86731471 AGCCCTGGTGCGGGATCCACTGG - Intergenic
958022715 3:88016110-88016132 AGCCCCGGTGGGGGATCCACTGG + Intergenic
959178656 3:102950656-102950678 AGCTCTGATGGTGCATGCCCTGG - Intergenic
960761592 3:121078470-121078492 GGCCCTGGTGCAGGATCCACTGG - Intronic
960963603 3:123089653-123089675 AGCTCTGGTGAAGCATGCCCTGG - Intronic
962600424 3:136987526-136987548 AGCCCTGGTGCGGGATCCACTGG - Intronic
963075805 3:141345323-141345345 AGATATGGAGGAGCAACCACAGG + Intronic
963397290 3:144750230-144750252 AGCCCTGGTGCGGGATCCACTGG + Intergenic
963589917 3:147245543-147245565 AGCCCCGGTGCAGGATCCACTGG - Intergenic
963742847 3:149097659-149097681 AGCCCAGGTGCAGGATCCACTGG - Intergenic
963744229 3:149109778-149109800 AGCCCGGGTGCAGGATCCACTGG + Intergenic
964014460 3:151928578-151928600 AGCTCCGGTGCGGGATCCACTGG + Intergenic
965220137 3:165918384-165918406 AGCACCGGTGCAGGATCCACTGG - Intergenic
965245166 3:166258406-166258428 AGCCCTGGTGTGGGATCCACTGG - Intergenic
965288119 3:166843233-166843255 AGCCCTGGTGTGGGATCCACTGG + Intergenic
965446539 3:168780530-168780552 AGCCCTGGTGCTGGATCCACTGG + Intergenic
965837448 3:172867204-172867226 AGCCCTGGTGTGGGATCCACTGG + Intergenic
966190938 3:177271666-177271688 AGCCCCGGTGCAGGATCCACTGG - Intergenic
967499077 3:190176987-190177009 AGCCCCGGTGCAGGATCCACTGG - Intergenic
971766905 4:30844134-30844156 AGTGCTTGTGAAGCATCCACAGG - Intronic
973587686 4:52409683-52409705 AGCCCTGGTGCGGGATCCACTGG - Intergenic
974484710 4:62491835-62491857 AGCCCAGGTGCAGGATCCACTGG - Intergenic
974781665 4:66561430-66561452 AGCCCTGGTGTGGGATCCACTGG - Intergenic
979755941 4:124339434-124339456 AGCCCTGGTGCGGGATCCACTGG + Intergenic
979784510 4:124698682-124698704 AGATATGGTGGAGCTTCCAGGGG + Intronic
982868727 4:160550046-160550068 AGCCCCGGTGCAGGATCCACTGG - Intergenic
983026171 4:162739963-162739985 AGCCCTGGTGTGGGATCCACTGG + Intergenic
984241767 4:177227503-177227525 AGCCCCGGTGCAGGATCCACTGG - Intergenic
984770640 4:183433567-183433589 AGCCCCGGTGCAGGATCCACTGG + Intergenic
984776032 4:183482626-183482648 AGCCCCGGTGGGGGATCCACTGG - Intergenic
985412033 4:189695627-189695649 GGCCCTGGTGCAGGATCCACTGG - Intergenic
985542884 5:494985-495007 AGCGCTTGTGGAGCAGCCAGCGG + Intronic
987156686 5:15096453-15096475 AGCCCTGGTGCGGGATCCACTGG - Intergenic
987383935 5:17311711-17311733 AGCCCCGGTGCAGGATCCACTGG - Intergenic
988177346 5:27743883-27743905 AGCCCTGGTGTGGGATCCACTGG + Intergenic
988489071 5:31691951-31691973 AGCCCTGGTGTGGGATCCACTGG - Intronic
988703699 5:33701999-33702021 GACTCTGGTGGTGCATGCACTGG + Intronic
992296811 5:75334108-75334130 AGCCCTGGTGCAGGATCCACTGG + Intergenic
992947523 5:81824136-81824158 AGCCCTGGTGCGGGATCCACTGG + Intergenic
993678531 5:90847455-90847477 AGCCCTGGTGCGGGATCCACTGG - Intronic
994251436 5:97541814-97541836 GGCCCTGGTGCAGGATCCACTGG - Intergenic
994701627 5:103141972-103141994 AGCCCTGGTGCGGGATCCACTGG - Intronic
995568745 5:113457566-113457588 AGCCCAGGTGCAGGATCCACTGG + Intronic
996107119 5:119517527-119517549 AGCCCTGGTGTGGGATCCACTGG + Intronic
996555416 5:124773491-124773513 AGAACTGGTGCAGCATTCACTGG + Intergenic
997352286 5:133239382-133239404 AGACCTGGTGCAGGATCCACTGG + Intronic
997972672 5:138416631-138416653 AACTTTGCTGGAGCATCCCCTGG + Intronic
998094805 5:139391127-139391149 ACCCCTGGTGGAGTATCCAGAGG - Exonic
1000291012 5:159871458-159871480 ATCTCTTGTAGAGCCTCCACAGG - Intergenic
1002081948 5:176742681-176742703 TGCTGTGCTGGAGCATCCCCAGG + Intergenic
1002961622 6:1920295-1920317 AGCTCTGGTGGAGAAGCCTGGGG - Intronic
1003836138 6:10074648-10074670 GGCTCTGGTGCGGGATCCACTGG - Intronic
1003908206 6:10721012-10721034 AGCCCTGGTGTGGGATCCACTGG + Intergenic
1004665459 6:17745245-17745267 AGCTCCGGTGCGGGATCCACTGG - Intergenic
1005117643 6:22356336-22356358 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1005596134 6:27381005-27381027 AGCCCTGGTGCGGGATCCACTGG - Intronic
1005689647 6:28290416-28290438 AGCTCTGGTGTTGCATGCATAGG - Intronic
1006020963 6:31117346-31117368 AGCTCTGGTGGTGGCTCCAGTGG - Exonic
1006258897 6:32852677-32852699 AGTTCTGGTAGAGCAACCACAGG - Intronic
1006593123 6:35172673-35172695 GGCTCTGGTGGGCCACCCACGGG - Intergenic
1007567903 6:42867044-42867066 GGCTCTGGAGGTGCAGCCACTGG + Exonic
1007738801 6:43998479-43998501 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1009407037 6:63326388-63326410 AGCCCTGGTGCAGAATCCACTGG - Intergenic
1009470343 6:64024157-64024179 AGCCCTGGTGCGGGATCCACTGG + Intronic
1011246595 6:85326391-85326413 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1011620027 6:89234426-89234448 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1011957118 6:93037234-93037256 AGCACTGGGGGAGAATCCATTGG + Intergenic
1013410710 6:109881083-109881105 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1013853302 6:114541787-114541809 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1014788549 6:125644876-125644898 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1015600423 6:134905153-134905175 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1016067294 6:139697861-139697883 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1016217278 6:141618637-141618659 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1018619269 6:165714750-165714772 GACTCTGGGGGTGCATCCACTGG - Intronic
1022174073 7:27856993-27857015 GGCCCTGGTGCAGGATCCACTGG - Intronic
1024335557 7:48202850-48202872 AGCCCTGGTGCGGGATCCACTGG - Intronic
1024443909 7:49454057-49454079 AGCTCCAGTGCAGGATCCACTGG + Intergenic
1025249763 7:57343996-57344018 AGCTCTGCTGGAGCACCCACTGG - Intergenic
1026512417 7:71038018-71038040 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1027667461 7:81057420-81057442 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1028070176 7:86440991-86441013 AGCCCTGGTGCTGGATCCACTGG + Intergenic
1030366948 7:108657187-108657209 AGCCCCAGTGCAGCATCCACTGG - Intergenic
1033664028 7:143424335-143424357 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1033678917 7:143573437-143573459 AACTTTGTTGGAGGATCCACTGG + Exonic
1033692921 7:143756017-143756039 AACTTTGTTGGAGGATCCACTGG - Exonic
1036636093 8:10550425-10550447 GGCTCTGGTGTAGCATCATCTGG + Intronic
1036915051 8:12796686-12796708 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1037263770 8:17036755-17036777 AGCCCTGGTGCGGGATCCACTGG - Intronic
1037474118 8:19239464-19239486 AGCTTTGTTGAAGCAGCCACAGG - Intergenic
1038861223 8:31390974-31390996 AGCTCTGATGGGGCATCTCCTGG - Intergenic
1039637379 8:39180550-39180572 AGCCCTGGTGCGGGATCCACTGG + Intronic
1040014551 8:42689935-42689957 AGCCCTGGTGTGGCATCCACCGG + Intergenic
1040024057 8:42765338-42765360 GGCACTGGTGGAGCACGCACAGG - Intronic
1040324023 8:46332112-46332134 AGCTCTGGTGTGGGATCAACTGG + Intergenic
1042174114 8:66022168-66022190 AGCTCTGCTGGAACATATACCGG + Intronic
1043701193 8:83290773-83290795 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1044075896 8:87821257-87821279 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1044788760 8:95824062-95824084 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1045344133 8:101279518-101279540 AGCATTTATGGAGCATCCACAGG - Intergenic
1046288981 8:112133115-112133137 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1046445414 8:114311773-114311795 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1046450783 8:114386578-114386600 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1047435183 8:124830105-124830127 AGCTCCTGTGGACCCTCCACTGG + Intergenic
1048757424 8:137755057-137755079 AGCCCTGGTGTGGGATCCACTGG - Intergenic
1052796916 9:32931386-32931408 AGCTTTGATGGAGCCTACACGGG + Intergenic
1054722528 9:68617446-68617468 AGCCCTGGTGCCGGATCCACTGG + Intergenic
1055102496 9:72480177-72480199 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1055754489 9:79543248-79543270 AGCTCTGGTGGCCCAACCAATGG - Intergenic
1056736005 9:89209781-89209803 AGCACTGGTGTGGGATCCACTGG + Intergenic
1057354730 9:94323811-94323833 AGCGGTGGTGGAGCCTGCACAGG - Intronic
1057653028 9:96933824-96933846 AGCGGTGGTGGAGCCTGCACAGG + Intronic
1058174796 9:101724053-101724075 AGCCCCGGTGCAGGATCCACTGG - Intronic
1058974712 9:110115170-110115192 AGCACTGCTGGACCATCCTCTGG - Intronic
1060594157 9:124838671-124838693 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1062230377 9:135479215-135479237 AGCTCGGGTGGGGCAGCCGCGGG + Intronic
1062462592 9:136668126-136668148 ATCTCCGCTGGAGCCTCCACCGG - Intronic
1203662805 Un_KI270753v1:61342-61364 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1203670561 Un_KI270755v1:7354-7376 GGCCCTGGTGCAGGATCCACTGG + Intergenic
1188156695 X:26749522-26749544 AGCTCTGCTGCAGCATCCTAGGG - Intergenic
1189167695 X:38877565-38877587 AGCGCTGGAGGAGCCTCCAAAGG + Intergenic
1190413895 X:50163270-50163292 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1193803967 X:85972297-85972319 AGCCCTGGTGCGGGATCCACTGG - Intronic
1196049151 X:111287142-111287164 GGCTCTGGAGGAGCATCACCAGG - Intergenic
1196845125 X:119891012-119891034 AGCCCTGGTGTGGGATCCACTGG + Intergenic
1197000215 X:121431467-121431489 AGCCCTGGGGCAGGATCCACTGG - Intergenic
1198300056 X:135325876-135325898 AGCCCCGGTGCAGGATCCACTGG + Intronic
1198744367 X:139874658-139874680 AGGTCTGCAGGAGCATCCCCAGG + Intronic
1199831727 X:151555130-151555152 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1200470824 Y:3584029-3584051 AGCCCTGGTGTGGGATCCACTGG - Intergenic
1201673061 Y:16546956-16546978 AGTTCTGCTGGAGCATCTGCTGG - Intergenic