ID: 1117339678

View in Genome Browser
Species Human (GRCh38)
Location 14:54782620-54782642
Sequence AACCCATCGATGCCGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 28}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117339674_1117339678 11 Left 1117339674 14:54782586-54782608 CCGTCTGCTCACGTATTGGCACG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1117339678 14:54782620-54782642 AACCCATCGATGCCGGAACATGG 0: 1
1: 0
2: 1
3: 0
4: 28
1117339673_1117339678 14 Left 1117339673 14:54782583-54782605 CCTCCGTCTGCTCACGTATTGGC 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1117339678 14:54782620-54782642 AACCCATCGATGCCGGAACATGG 0: 1
1: 0
2: 1
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117339678 Original CRISPR AACCCATCGATGCCGGAACA TGG Intronic
903929599 1:26854605-26854627 AACCCACCCATGCCGGGACCTGG - Exonic
917260422 1:173161057-173161079 AACCCATTGATTTCTGAACAAGG - Intergenic
1066491769 10:35901112-35901134 AACCCATGGATGATGGATCATGG + Intergenic
1075961634 10:126571990-126572012 TAAGCATCGATGCCGGACCAGGG - Intronic
1094668766 12:32548212-32548234 CACACATGGATGCCGCAACAGGG - Intronic
1098150965 12:67545837-67545859 AATACATTGATGCCTGAACATGG - Intergenic
1113631873 13:111893731-111893753 AACCCCTCGAGGCTGGAGCACGG + Intergenic
1117339678 14:54782620-54782642 AACCCATCGATGCCGGAACATGG + Intronic
1119424215 14:74525192-74525214 ACCCCACCAATGCCTGAACAGGG - Exonic
1133744162 16:8674624-8674646 CACCCAGCGCTGCCGGAACTCGG + Intronic
1136661518 16:31767130-31767152 AACCCATGGTTCCCGGAAGAAGG - Intronic
1143973446 17:10812747-10812769 AATCCAGCGATGCCAGAAAATGG - Intergenic
1149955680 17:61046693-61046715 AACCCATAGATGCGGAACCAGGG + Intronic
1154371409 18:13765973-13765995 CACCCATGGATGCCGGCAAATGG - Intergenic
1155086918 18:22467724-22467746 AACCCATCGATTCTGGAACATGG - Intergenic
1163750481 19:19074201-19074223 AACCCATAGAGACCGCAACAAGG + Intronic
1173012012 20:39191285-39191307 AACCCACACTTGCCGGAACAGGG - Intergenic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
950518331 3:13481347-13481369 ATCCCTTTGATGCCGGAAAATGG + Exonic
963648439 3:147946218-147946240 AACCCACAGCTGCTGGAACATGG + Intergenic
970260374 4:14218005-14218027 AACCCAACCATGCTGGTACAAGG + Intergenic
972524936 4:39899890-39899912 GACACATGGATGCTGGAACAGGG - Intronic
1004581370 6:16956943-16956965 ATCCCATCAATGCCGGTAAACGG - Intergenic
1027875939 7:83768119-83768141 AACCCATCATTCCTGGAACAAGG - Intergenic
1036549024 8:9800591-9800613 AACCCATGGTTCCCGGAAGAAGG + Intergenic
1038435634 8:27533952-27533974 AACCCATGGAAGCCTGGACAGGG - Intronic
1041439002 8:57873974-57873996 AAACCATCCATGCCTTAACACGG + Intergenic
1045678538 8:104633757-104633779 AACTCATTGATGCCCAAACATGG - Intronic
1051439175 9:17065707-17065729 AAGCCATGAATGCCAGAACAAGG - Intergenic
1199623580 X:149720665-149720687 AACCCATGGTTCCCGGAAGAAGG + Intergenic