ID: 1117343125

View in Genome Browser
Species Human (GRCh38)
Location 14:54808359-54808381
Sequence GGTGCCAAACAGGAACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117343125_1117343129 6 Left 1117343125 14:54808359-54808381 CCAGCTGGTTCCTGTTTGGCACC No data
Right 1117343129 14:54808388-54808410 AAACCATGAATCCAGCTCTTGGG No data
1117343125_1117343128 5 Left 1117343125 14:54808359-54808381 CCAGCTGGTTCCTGTTTGGCACC No data
Right 1117343128 14:54808387-54808409 AAAACCATGAATCCAGCTCTTGG No data
1117343125_1117343133 18 Left 1117343125 14:54808359-54808381 CCAGCTGGTTCCTGTTTGGCACC No data
Right 1117343133 14:54808400-54808422 CAGCTCTTGGGATGAAAGTAGGG No data
1117343125_1117343132 17 Left 1117343125 14:54808359-54808381 CCAGCTGGTTCCTGTTTGGCACC No data
Right 1117343132 14:54808399-54808421 CCAGCTCTTGGGATGAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117343125 Original CRISPR GGTGCCAAACAGGAACCAGC TGG (reversed) Intergenic