ID: 1117343126

View in Genome Browser
Species Human (GRCh38)
Location 14:54808369-54808391
Sequence GTTTTTTGCAGGTGCCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117343126_1117343132 7 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343132 14:54808399-54808421 CCAGCTCTTGGGATGAAAGTAGG No data
1117343126_1117343134 25 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343134 14:54808417-54808439 GTAGGGCCTGAAAAACCATCTGG No data
1117343126_1117343133 8 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343133 14:54808400-54808422 CAGCTCTTGGGATGAAAGTAGGG No data
1117343126_1117343129 -4 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343129 14:54808388-54808410 AAACCATGAATCCAGCTCTTGGG No data
1117343126_1117343135 29 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343135 14:54808421-54808443 GGCCTGAAAAACCATCTGGATGG No data
1117343126_1117343136 30 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343136 14:54808422-54808444 GCCTGAAAAACCATCTGGATGGG No data
1117343126_1117343128 -5 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343128 14:54808387-54808409 AAAACCATGAATCCAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117343126 Original CRISPR GTTTTTTGCAGGTGCCAAAC AGG (reversed) Intergenic
No off target data available for this crispr