ID: 1117343133

View in Genome Browser
Species Human (GRCh38)
Location 14:54808400-54808422
Sequence CAGCTCTTGGGATGAAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117343126_1117343133 8 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343133 14:54808400-54808422 CAGCTCTTGGGATGAAAGTAGGG No data
1117343125_1117343133 18 Left 1117343125 14:54808359-54808381 CCAGCTGGTTCCTGTTTGGCACC No data
Right 1117343133 14:54808400-54808422 CAGCTCTTGGGATGAAAGTAGGG No data
1117343124_1117343133 19 Left 1117343124 14:54808358-54808380 CCCAGCTGGTTCCTGTTTGGCAC No data
Right 1117343133 14:54808400-54808422 CAGCTCTTGGGATGAAAGTAGGG No data
1117343127_1117343133 -3 Left 1117343127 14:54808380-54808402 CCTGCAAAAAACCATGAATCCAG No data
Right 1117343133 14:54808400-54808422 CAGCTCTTGGGATGAAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117343133 Original CRISPR CAGCTCTTGGGATGAAAGTA GGG Intergenic
No off target data available for this crispr