ID: 1117343135

View in Genome Browser
Species Human (GRCh38)
Location 14:54808421-54808443
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117343131_1117343135 -1 Left 1117343131 14:54808399-54808421 CCAGCTCTTGGGATGAAAGTAGG No data
Right 1117343135 14:54808421-54808443 GGCCTGAAAAACCATCTGGATGG No data
1117343126_1117343135 29 Left 1117343126 14:54808369-54808391 CCTGTTTGGCACCTGCAAAAAAC No data
Right 1117343135 14:54808421-54808443 GGCCTGAAAAACCATCTGGATGG No data
1117343130_1117343135 7 Left 1117343130 14:54808391-54808413 CCATGAATCCAGCTCTTGGGATG No data
Right 1117343135 14:54808421-54808443 GGCCTGAAAAACCATCTGGATGG No data
1117343127_1117343135 18 Left 1117343127 14:54808380-54808402 CCTGCAAAAAACCATGAATCCAG No data
Right 1117343135 14:54808421-54808443 GGCCTGAAAAACCATCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117343135 Original CRISPR GGCCTGAAAAACCATCTGGA TGG Intergenic
No off target data available for this crispr