ID: 1117346760

View in Genome Browser
Species Human (GRCh38)
Location 14:54840448-54840470
Sequence AGACAGAACCAGACCAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117346758_1117346760 -10 Left 1117346758 14:54840435-54840457 CCAGTTAAAAGCCAGACAGAACC No data
Right 1117346760 14:54840448-54840470 AGACAGAACCAGACCAAGCTAGG No data
1117346757_1117346760 7 Left 1117346757 14:54840418-54840440 CCAAGGAGAGCTATGTTCCAGTT No data
Right 1117346760 14:54840448-54840470 AGACAGAACCAGACCAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117346760 Original CRISPR AGACAGAACCAGACCAAGCT AGG Intergenic
No off target data available for this crispr