ID: 1117348582

View in Genome Browser
Species Human (GRCh38)
Location 14:54858686-54858708
Sequence AAGAACAAGATGAAGGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 415}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117348582 Original CRISPR AAGAACAAGATGAAGGGGTC GGG (reversed) Intronic
900876650 1:5347709-5347731 AAGAACAAGAGGACAGGGGCTGG + Intergenic
900895803 1:5482154-5482176 ATGAACAAGATAAGGGGCTCGGG - Intergenic
901176536 1:7303816-7303838 AGGAAAGAGCTGAAGGGGTCAGG + Intronic
901682795 1:10924635-10924657 AAGTCCAAGATCAAGGTGTCAGG - Intergenic
901761091 1:11472077-11472099 CAGGACAAGATGCAGGGGCCAGG - Intergenic
902735375 1:18397331-18397353 AAGATCAAGATGTTGGTGTCTGG - Intergenic
902974616 1:20080007-20080029 AGGAACAAGAGGAAGAGGACGGG + Intronic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
903167773 1:21532950-21532972 GAGAAAAAGATGAAGGTGTTGGG + Intronic
905150299 1:35921823-35921845 AAGAACAGAATGGAGGGCTCTGG + Exonic
905303269 1:36999783-36999805 AAGAAATAGAAGATGGGGTCAGG - Intronic
906515913 1:46438719-46438741 AAGAAACATTTGAAGGGGTCTGG - Intergenic
907166819 1:52419371-52419393 AAGAAGAAGAAGAATGGGTTTGG + Exonic
907387303 1:54134343-54134365 AGGAACAAGATGTGGGGGCCTGG + Intronic
907523610 1:55040652-55040674 AAGAACCAGCTGAAGGGGCAGGG + Intronic
908029614 1:59985856-59985878 AAGAACAAGCTGGAGCTGTCTGG + Intergenic
908035786 1:60051317-60051339 AAGCACAACATGAATGGGGCAGG - Intronic
909717300 1:78724869-78724891 AAGTCCAAGATCAAGGTGTCTGG - Intergenic
909774918 1:79471838-79471860 AAGGTCAAGATGAAGGGGCAAGG + Intergenic
910368550 1:86491847-86491869 AGGACCAAGATCCAGGGGTCTGG - Intronic
910427342 1:87130677-87130699 CAGAACCAGATGAAGAAGTCAGG - Intronic
911065054 1:93780580-93780602 AAAAACAAGATGGAGGAGCCAGG + Intronic
911285217 1:95983324-95983346 AAGAATAATTTGTAGGGGTCGGG + Intergenic
911388821 1:97212990-97213012 AAGACCAAGATCAAGGTGTCTGG + Intronic
912870737 1:113302964-113302986 AAGAGAAAGATGAAGGGGAGGGG + Intergenic
913370469 1:118093483-118093505 AAGAAGAAGAAGAAAGGTTCAGG - Intronic
913986398 1:143569767-143569789 AAGAAGAATAGGAAGGGGTGTGG + Intergenic
914204782 1:145517552-145517574 AAGAAGAAGAGGAAGGAGTGTGG + Intergenic
914370780 1:147022675-147022697 AAGAAGAAGAGGAAGGAGTGTGG - Intergenic
914805050 1:150985513-150985535 AAGAAAAAGAGGTAGGGGTGGGG - Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
915269884 1:154746507-154746529 AGGAAGAAGATGGAGGGGTTTGG - Intronic
915307730 1:154990310-154990332 AAGAAACAGAAGTAGGGGTCGGG - Intronic
915578093 1:156794636-156794658 AAGAAAAAAATGCAGGAGTCAGG - Intronic
915838213 1:159195015-159195037 AAGAAGAGGATGAAGGGCTTTGG - Intronic
915920000 1:159969048-159969070 AAGAAGAAGAAGAAGAGGTAGGG + Intergenic
916031212 1:160879085-160879107 AAGACCAAAATCAAGGGGTGAGG - Intronic
917276369 1:173336034-173336056 AATAACTACATGATGGGGTCAGG - Intergenic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
919498201 1:198303495-198303517 AAAAACAAGATGAAAGTGTCAGG + Intronic
919725969 1:200884169-200884191 AAGATGATGATGGAGGGGTCAGG + Intergenic
920398974 1:205665390-205665412 AAGACCAGGATGAAGGGGAAAGG + Intronic
921798714 1:219377766-219377788 GAGAACAAGATGTAAGAGTCGGG - Intergenic
922777155 1:228220267-228220289 AGGAAGAAGATGAAGATGTCCGG - Intronic
923212782 1:231820599-231820621 AAGAACAAGATAGAAGAGTCTGG - Intronic
923983979 1:239358592-239358614 TAAAACAAGAAGCAGGGGTCAGG + Intergenic
924232817 1:241976622-241976644 AAGAAAAAGAGAAAGGGGTTTGG - Intergenic
924350555 1:243110180-243110202 AAGAACAAGCTTAATGGATCTGG + Intergenic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063172003 10:3517452-3517474 AAGATCAAGATGATGTGGTCGGG - Intergenic
1063566769 10:7177997-7178019 AAGTCCAAGATGAAGGTGCCAGG - Intronic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1065026902 10:21547163-21547185 AATAAAAGAATGAAGGGGTCAGG - Intronic
1065118301 10:22503632-22503654 AAGAAAAGGATGGATGGGTCAGG + Intergenic
1065642793 10:27802435-27802457 AAGAACAAAAAGAAGGGACCGGG - Intergenic
1066181064 10:32961176-32961198 AAGAAAAAGATGAAGGGATAGGG + Intronic
1067365081 10:45619524-45619546 AAGAACAAGTGGAAGGAGTGAGG + Intronic
1067541936 10:47161122-47161144 AAGAAGAAGAGGAGGGGGCCGGG - Intergenic
1068150593 10:53125767-53125789 AAGGACAAGATGAAGGTGAATGG + Intergenic
1068470523 10:57456734-57456756 AAGAACAATTTGAAGGTGTGAGG + Intergenic
1069473114 10:68710632-68710654 AAGAAGAAGAAGAAAGGGCCAGG - Intergenic
1070338630 10:75476839-75476861 AAGTCCAAGATGAAAGTGTCAGG + Intronic
1070541679 10:77419890-77419912 AAGAAGAAAGTGAAGAGGTCAGG + Intronic
1071427644 10:85575417-85575439 CAGAAAAAGATTAAGGGATCAGG - Intergenic
1072112512 10:92336640-92336662 AAGAAGAAGAGGAAGGGGCATGG + Intronic
1072317075 10:94213532-94213554 AAGCAGAAGAGGAAGAGGTCTGG - Intronic
1072628350 10:97128726-97128748 AAGAGCAAGATGAAGAGGAAAGG + Intronic
1072876863 10:99182024-99182046 AAGACTAAGATTAAGGTGTCAGG - Intronic
1073045298 10:100634244-100634266 AAGGACAAGGTGAAGGGCTGTGG - Intergenic
1073148537 10:101296141-101296163 AAGTCCAAGATCAAGGGGCCAGG - Intergenic
1074259517 10:111837936-111837958 AAGAACTACATGCAGGGCTCTGG + Intergenic
1074713415 10:116196880-116196902 AAGATCAAAATTAAGGTGTCAGG + Intronic
1074784802 10:116829478-116829500 AAGACCAAGAGGAAGGGCTCTGG + Intergenic
1074890848 10:117735562-117735584 AAGTACAAGGGGAAGTGGTCAGG - Intergenic
1075875768 10:125804385-125804407 AACAGCCAGATGAAGAGGTCTGG - Intronic
1076311444 10:129510667-129510689 AAGAAATAGATGATGGGTTCAGG + Intronic
1076917645 10:133432597-133432619 AAGTACAAGATAAAGATGTCAGG - Intergenic
1076937641 10:133576672-133576694 AAGTACAAGATAAAGATGTCAGG - Intergenic
1078450880 11:11439876-11439898 AAGAACAGGATGATGGAGGCAGG + Intronic
1078469441 11:11575339-11575361 AAGAGAAAGATGTAGGGGTTAGG - Intronic
1079279952 11:19078098-19078120 CAGCACAAGAGGAATGGGTCAGG + Intergenic
1080787376 11:35487759-35487781 AAGAACAAGAGTAAGGGGTCTGG + Intronic
1081745418 11:45469451-45469473 GAGAAAATGAGGAAGGGGTCTGG - Intergenic
1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG + Intergenic
1082226181 11:49710381-49710403 AAGAATAATATGAATGGGTCTGG + Intergenic
1082556880 11:54573823-54573845 AAGAAAAAGCACAAGGGGTCAGG + Intergenic
1082666599 11:55982685-55982707 ACGAACAAGATCACGGGGTGGGG - Intergenic
1082666655 11:55982997-55983019 AGGAACAATATCAAGGGGGCGGG - Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1084015954 11:66381728-66381750 AAAAACAAGTTTAAGGAGTCAGG - Intergenic
1084019564 11:66409529-66409551 GAGAAAAAGTTTAAGGGGTCGGG - Intergenic
1085496178 11:76971893-76971915 TAGATCCAGATGAAGGGGTGGGG + Intronic
1086622908 11:88909370-88909392 AAGAATAATATGAACGAGTCTGG - Intronic
1086845593 11:91746143-91746165 AAGAACAAGATCAAGGTGCCAGG - Intergenic
1087356800 11:97103768-97103790 AAGTCCAAGATCAAGGTGTCAGG - Intergenic
1087713628 11:101583007-101583029 GAGCGCAGGATGAAGGGGTCTGG + Intronic
1087752289 11:102020095-102020117 AAGAAGAAGAAGAAGAGGCCAGG + Intergenic
1088942471 11:114474061-114474083 AAAATAAAGATGAAGAGGTCTGG + Intergenic
1089264882 11:117251613-117251635 AAGAAAAAGTAGCAGGGGTCAGG + Intronic
1089790058 11:120936342-120936364 AAGAACAAGATGAAGGTCAAAGG + Intronic
1090452627 11:126820132-126820154 ATGAACAAAATGAATGGGGCAGG - Intronic
1092072188 12:5640356-5640378 GAGCATGAGATGAAGGGGTCAGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092629312 12:10361342-10361364 AAGAACAGGAAGAAGAGGGCAGG + Intergenic
1092746497 12:11677223-11677245 AAGAACAAGATAGATGGGTCTGG + Intronic
1092983271 12:13819252-13819274 AAGTGCAAGATCAAGGTGTCAGG - Intronic
1093763096 12:22932306-22932328 AAGTTCAAGATCAAGGGGCCAGG - Intergenic
1094161207 12:27392934-27392956 AAGAGCAAGATGATGGGGTAGGG - Intronic
1095101356 12:38188354-38188376 ATAAACAGGATGAAGGGGCCAGG + Intergenic
1095293816 12:40506230-40506252 AAGAATAGGATCAAGAGGTCTGG - Intronic
1095294122 12:40509185-40509207 AAGAATAGGATCAAGAGGTCTGG - Intronic
1095649951 12:44595734-44595756 AAAAACAAGTTAAAGGGGCCAGG - Intronic
1096584529 12:52611190-52611212 AAGAAGCAGGTGAAGGGGACTGG - Exonic
1096995157 12:55833685-55833707 AAAAAAAAGTTGAAGGAGTCAGG + Intergenic
1098231478 12:68375810-68375832 GAGAAAAAGATGAAGGAGTATGG - Intergenic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1098306674 12:69109394-69109416 AAGTAGAAGATGAACGGGGCTGG - Intergenic
1100037629 12:90272446-90272468 AGGAACAAGATGAAGGAATTTGG - Intergenic
1100045859 12:90379941-90379963 CAGAACAAGTTGAAAGTGTCAGG + Intergenic
1100512130 12:95285971-95285993 AAAAAAAAAAAGAAGGGGTCGGG - Intronic
1102167844 12:110820695-110820717 AAGAAGAAGAAGGAGGGGACTGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103282830 12:119774675-119774697 AAAAACAAGATAAAATGGTCAGG + Intronic
1104777701 12:131400971-131400993 CAGAAGAGGATGAAGGGGGCGGG - Intergenic
1105284598 13:18993964-18993986 AAGAACAAGACGAGGAGGCCAGG + Intergenic
1106613107 13:31302074-31302096 AAGAAAATGATGAAGGGGAGAGG - Intronic
1108716257 13:53081033-53081055 AAGACCAAGATCAAGGTGTCAGG - Intergenic
1108757046 13:53515860-53515882 AGGAACAAGATGAAAGGGTTAGG - Intergenic
1108803294 13:54126651-54126673 AATAACAAGATCAAGGTGGCTGG - Intergenic
1109423835 13:62147093-62147115 AAGAACAGGAGCAAGGGGTGGGG + Intergenic
1110164808 13:72428346-72428368 AAGAACAAGATAAGAGGGTACGG + Intergenic
1110425771 13:75364551-75364573 AAGAAAATGATGAAGGGTTGAGG - Intronic
1111542358 13:89685755-89685777 AAGAAAAACGTGGAGGGGTCTGG - Intergenic
1112262665 13:97891632-97891654 GTGAATAAAATGAAGGGGTCTGG + Intergenic
1112770417 13:102789006-102789028 AAGATCACGATGAAGAGGTAAGG - Exonic
1113345350 13:109472363-109472385 AAGAAGAAGAAGAAGGGGAAAGG + Intergenic
1113345998 13:109479205-109479227 AAGACCAAGATGGGGGTGTCTGG - Intergenic
1113773976 13:112931914-112931936 AAGAACAAGATGAAGAAGCGTGG + Intronic
1116231114 14:42218010-42218032 ATGTACAAAATGAAGGGGTATGG - Intergenic
1117026390 14:51624545-51624567 AAAAACAAGATGAATGTGTAGGG + Intronic
1117348582 14:54858686-54858708 AAGAACAAGATGAAGGGGTCGGG - Intronic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117799328 14:59427157-59427179 AAGCCCAACATGAAGGGGTGTGG - Intergenic
1118045674 14:61968316-61968338 AAGAAGAAGATAAAGGGGTGTGG + Intergenic
1119556252 14:75555423-75555445 AAGAGCAAGATGGAAGGGGCTGG + Intergenic
1120872092 14:89347007-89347029 AAGAACAAAATGGTGGGGTGGGG - Intronic
1121609207 14:95264328-95264350 TAAAATAAGATGCAGGGGTCCGG - Intronic
1121702878 14:95969208-95969230 ATGAACATGATGAAGCTGTCTGG - Intergenic
1122994244 14:105254018-105254040 ACGATCAAGATGCAGGGGCCTGG - Intronic
1124196427 15:27634652-27634674 AAGAAAAAGAGGAAGAGGACAGG - Intergenic
1124429231 15:29592033-29592055 AAGTCCAAGATCAAGGTGTCAGG - Intergenic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1126442058 15:48700006-48700028 AAGAAAAAAAAGAAGGGGTCGGG + Intergenic
1128715359 15:69903816-69903838 GAGAGCAAGATGAAGGGTTGGGG - Intergenic
1130871237 15:87973849-87973871 AAGAGCAAAATGAAGGTGGCAGG - Intronic
1131235472 15:90693049-90693071 AAAAAAAAGAAGAAGAGGTCGGG - Intergenic
1131352356 15:91712849-91712871 AAGGACAAAAAGAAGGGGTTTGG - Intergenic
1131413221 15:92228595-92228617 AAGAAAAGGATGAGGGGGTTGGG + Intergenic
1131864855 15:96697012-96697034 AATAATAAGACGAAGAGGTCTGG - Intergenic
1132990155 16:2788126-2788148 CAGAGCAAGATGCTGGGGTCAGG + Intergenic
1133556553 16:6911339-6911361 AAGTCCAAGATCAAGGTGTCAGG + Intronic
1133935395 16:10265104-10265126 AAGAAAATGAAGCAGGGGTCCGG + Intergenic
1134234796 16:12457060-12457082 AAGAAAAGGGTAAAGGGGTCTGG - Intronic
1135174297 16:20214567-20214589 GAGAAGAAGAGGAAGGGGTGGGG + Intergenic
1135677668 16:24430811-24430833 AAGTTCAAGATCAAGGTGTCAGG - Intergenic
1135938292 16:26799384-26799406 AATAACCAGATGAAGGAGTGTGG + Intergenic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1137226537 16:46516927-46516949 TAGAAAGAGATGAAGGGGCCTGG - Intergenic
1137294853 16:47081775-47081797 AATAACATGATTAAAGGGTCAGG + Exonic
1137550565 16:49434730-49434752 AAGAAGAAGATGAAGGTGTTAGG + Intergenic
1137644587 16:50063095-50063117 AAGAGCAAAATGAAGAGGTGAGG + Intergenic
1137787084 16:51148882-51148904 AAGAAAAAGAGGAGGGGGTGGGG + Intronic
1137800564 16:51258734-51258756 AAGTCCAAGATCAAGGTGTCGGG - Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138552418 16:57754897-57754919 AAGGAAAAGATGACTGGGTCCGG - Intronic
1138957490 16:61988961-61988983 AAGAAAAAAATGAGAGGGTCAGG + Intronic
1139229956 16:65274023-65274045 AATAACAGGATGAAGGGGTCGGG + Intergenic
1140093984 16:71859837-71859859 GGGAACAGGATGATGGGGTCAGG - Exonic
1140112546 16:72016312-72016334 AAGAGGAAGAGGAAGGGGACTGG + Intronic
1140717387 16:77739083-77739105 AAGAGGAATATGAAGGGGCCTGG - Intronic
1142513177 17:410613-410635 AAGAAGAAGACCAAGGGGTCTGG + Exonic
1142979747 17:3664665-3664687 ACGGACAAGGTGAGGGGGTCTGG - Exonic
1143512033 17:7401861-7401883 AAGAACAAGATGGAGAGGGGAGG - Intronic
1144031793 17:11329699-11329721 AAGAACCAGTTGGAGGGGACAGG + Intronic
1146789159 17:35741883-35741905 AGGACCACGATCAAGGGGTCCGG + Exonic
1147337186 17:39734225-39734247 AAAAAAAAAAAGAAGGGGTCAGG - Intergenic
1147517848 17:41139086-41139108 CAGAACAAGATGACAGGATCGGG + Intergenic
1147521716 17:41179510-41179532 AAGAACCAGATGGAGGGGATTGG + Intergenic
1147651583 17:42065258-42065280 AAGTCCAAGATCAAGGTGTCAGG - Intronic
1148014218 17:44509688-44509710 AAGAAAGAGAGGAAGGGGCCAGG + Intergenic
1148492250 17:48030804-48030826 CAAAACAAGATGCAGGGCTCTGG - Intronic
1149576342 17:57716145-57716167 AAGAAGAAGATAAAGAGGACAGG + Intergenic
1150204280 17:63389974-63389996 AAGGACAGGATGAAGGTGTCTGG - Intronic
1151040028 17:70848617-70848639 AAAGAGAAGATGAAAGGGTCTGG - Intergenic
1151326771 17:73384501-73384523 GAGAACTTGATGAAGGGGTGAGG - Intronic
1151611653 17:75180043-75180065 TAGAACAATCTGAAGGGGCCAGG + Intergenic
1152635989 17:81430743-81430765 AAGGAGGAGCTGAAGGGGTCTGG - Intronic
1153008379 18:515687-515709 AAGAACTGGATGAAGGGGCATGG - Intergenic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1155254015 18:23978921-23978943 AAAAAAAAAAGGAAGGGGTCAGG + Intergenic
1156695044 18:39755642-39755664 AATAAATAGATGAAGGGGCCAGG + Intergenic
1156927450 18:42598686-42598708 AAGTACAAGATGGAGGCATCAGG - Intergenic
1157076181 18:44470289-44470311 AAGGACAGGATGAAGAGGGCAGG + Intergenic
1157651570 18:49337844-49337866 AAGAACAAGAAGAAGGGGAAGGG + Intronic
1158983470 18:62788899-62788921 AACAACAAGATGAAAGGGCCTGG - Intronic
1160011424 18:75109543-75109565 AAGAACAAGAGTAAAAGGTCAGG - Intergenic
1161274130 19:3405896-3405918 AAGAAAAAGAAAAAGGGGCCGGG - Intronic
1162049664 19:8025293-8025315 AAGAATAGGAAGAAGGGGCCGGG - Intronic
1162920041 19:13895559-13895581 CAGAGGAAGATGAAGGGGTGGGG + Intronic
1163235660 19:16029093-16029115 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
1163796413 19:19340820-19340842 CAAAACAAGAGGCAGGGGTCAGG - Intronic
1165961784 19:39540773-39540795 AAGAAGAAGAGGAAGGGTTCTGG - Intergenic
1166136558 19:40780688-40780710 AAGAAAAAGAGGTAGGGGCCAGG + Intronic
1167396948 19:49235887-49235909 AAAAACAACATAAATGGGTCAGG + Intergenic
1167836929 19:52080578-52080600 AAGAACAAGGTGAAAGGTTAGGG + Intronic
1168105570 19:54163954-54163976 AAGAAGAAGAAGAAGAGGCCGGG - Intronic
1202644774 1_KI270706v1_random:130089-130111 AAGAACAGTATGATGGGGTGTGG - Intergenic
926137691 2:10348054-10348076 AAGATCAAGTTCAAGGGGGCAGG + Intronic
926396599 2:12449191-12449213 AAGAAAAAGATGCAGAGGGCAGG - Intergenic
926715865 2:15922990-15923012 AAGAAAAAAAAGAAGGTGTCAGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926989256 2:18659879-18659901 AAGAAAAGGAGAAAGGGGTCAGG - Intergenic
927840630 2:26440705-26440727 AGGAACAAGATGAATGGGGACGG - Intronic
927857424 2:26536223-26536245 ATGAACAAAATGAAGGGTTATGG - Intronic
927866188 2:26589195-26589217 AAGAAGAAGAGGAAGGGGAAGGG - Intronic
928195469 2:29213686-29213708 AAGACAAAGCTGAAGGGGCCAGG + Intronic
928962070 2:36937371-36937393 AAGAAAAAGAAAAAGAGGTCGGG + Intronic
929003219 2:37368318-37368340 CAGGAGAAGATGCAGGGGTCGGG - Intronic
929180859 2:39037227-39037249 AACAACAAGAGGATGGAGTCAGG + Intronic
929489822 2:42386200-42386222 AAGAAGAAGAAGAGGGGGCCAGG + Intronic
930140911 2:47950581-47950603 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
932319497 2:70811268-70811290 AAGGCCAAGATGAAGGTGTATGG - Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
936401762 2:112169943-112169965 AAGAAAAGGAAGAAGGGGCCAGG + Intronic
937216904 2:120318675-120318697 GAGAACAGGATGCAGGGGTGGGG + Intergenic
937680341 2:124637255-124637277 AAAAGCAAAAAGAAGGGGTCAGG - Intronic
937680430 2:124638659-124638681 AAGAACAAGATGAAGGCAATAGG - Intronic
938142467 2:128807807-128807829 AAAAACAAGATGAAGTCCTCAGG - Intergenic
938923419 2:136016532-136016554 ATGAACAAGAAGCAGGGCTCAGG - Intergenic
939881434 2:147635760-147635782 AAGTACAAGGTGAATGTGTCAGG - Intergenic
942184551 2:173412406-173412428 AAGAATAATAAGTAGGGGTCGGG - Intergenic
943717517 2:191168336-191168358 AATAAGATGATGTAGGGGTCAGG + Intergenic
943862566 2:192887569-192887591 CAGAAACAGATGAAGAGGTCAGG - Intergenic
944246485 2:197535591-197535613 AAGGCCAAGATGAAGGTGTGTGG + Exonic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945621953 2:212150687-212150709 AAGCACAAGAAGAATGAGTCTGG - Intronic
945752626 2:213807225-213807247 AAGAAAAACATGAAGGAGTATGG - Intronic
946068077 2:217007260-217007282 AAGAATAAGATGAATAGGTAGGG + Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946814692 2:223564882-223564904 AATAACAAGAAAAAGGGGCCGGG + Intergenic
947897866 2:233692239-233692261 AAGAACAAGATATGGGGGTATGG - Intronic
949035882 2:241815596-241815618 AAGAATAAGAGGAAGGGGTGGGG - Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1168974644 20:1954943-1954965 AAAAAAAAGAAGAAGGGGCCAGG - Intergenic
1169894626 20:10489643-10489665 TAGCACAAGAGTAAGGGGTCAGG + Intronic
1170565049 20:17595191-17595213 AAGGACAAGAAAAAGGGCTCTGG - Intronic
1170685139 20:18562895-18562917 AAGAACGAGAGGAAGAGGTGGGG - Intergenic
1171184520 20:23115422-23115444 AAGAAAAAGAGGTAGGGGTCAGG - Intergenic
1171257216 20:23698536-23698558 ATGAAATAGAAGAAGGGGTCTGG + Intergenic
1171396883 20:24840381-24840403 AAGAAAAAGAGGAATGTGTCTGG - Intergenic
1172084730 20:32372179-32372201 AAAATTAAGATGAAGGGGCCTGG - Intronic
1173198648 20:40937771-40937793 AAGAAAAGGAAGAAGGGGCCAGG + Intergenic
1173202829 20:40966698-40966720 AAGAAAAAGATGAAGGCCTGAGG + Intergenic
1173400183 20:42719288-42719310 AAGAGAAATATGAAGGGGTATGG + Intronic
1174702358 20:52621694-52621716 AATAACAAGAAGAAGTGGTTTGG - Intergenic
1174706353 20:52660274-52660296 AAGAACAAAATGAAGGAGGGTGG + Intergenic
1174903141 20:54521979-54522001 AAGAACAATATGAAGCAGTTTGG - Intronic
1175049337 20:56139649-56139671 AAGAACAAGATAAAGGAATTGGG + Intergenic
1175361032 20:58412978-58413000 CAGCACAACATGAAGAGGTCAGG - Intronic
1175979086 20:62728042-62728064 AAGAGCCAGATGATGGGGCCGGG - Intronic
1177267665 21:18805449-18805471 AAGAACAAGATGGAGGACACAGG + Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1178379141 21:32093579-32093601 AAGGATAAGAGGAAGGGGTAAGG - Intergenic
1180761418 22:18211311-18211333 TAGCAAAAGATGAAAGGGTCAGG + Intergenic
1180774249 22:18413308-18413330 TAGCAAAAGATGAAAGGGTCAGG - Intergenic
1181070360 22:20332311-20332333 TAGCAAAAGATGAAAGGGTCAGG - Intergenic
1181193350 22:21160260-21160282 TAGCAAAAGATGAAAGGGTCAGG - Intergenic
1181216093 22:21332340-21332362 TAGCAAAAGATGAAAGGGTCAGG + Intergenic
1182759666 22:32712016-32712038 AAGACCAAGATGTAGGGCTGTGG - Intronic
1183378896 22:37480772-37480794 AGGAAGGAGAAGAAGGGGTCAGG + Intronic
1183388652 22:37530331-37530353 AAGTCCAAGATCAAGGAGTCAGG + Intergenic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1184964965 22:47965011-47965033 AAGCACAGGATGAAGTGGTCAGG - Intergenic
949808933 3:7985191-7985213 TAGAACATGATGATGGGGTTTGG + Intergenic
950163573 3:10777603-10777625 ATGAACAAGATTAAGGGGAAAGG - Intergenic
951356190 3:21669994-21670016 AAGATTAAGATGAAGTTGTCAGG - Intronic
952290052 3:32006234-32006256 TAAAACAAGATGGAGGGGTGCGG - Intronic
952391339 3:32883364-32883386 AAGGCCAAGATCAAGGTGTCGGG + Intronic
952468808 3:33621847-33621869 AAGATGAAAATGAATGGGTCTGG - Intronic
953590561 3:44248760-44248782 AAGTAGAAGATGAAAGGGTGAGG + Intronic
954245190 3:49325848-49325870 ATGAACAAGAGGCAGGGGTGAGG + Intronic
954944031 3:54401492-54401514 AAGAACAAGAGAAAAGTGTCAGG + Intronic
955486391 3:59438825-59438847 AGGAAGAAGAAGGAGGGGTCTGG + Intergenic
956198914 3:66684703-66684725 AAGAATAAGATGCAGTGGACGGG + Intergenic
956671284 3:71693396-71693418 GAGAACAAGACGAAGGGGTTAGG + Intronic
957931442 3:86882941-86882963 AAGTCCAAGATCAAGGTGTCAGG - Intergenic
958529118 3:95302064-95302086 AAGAAGAAGAAGAAGAGGTATGG + Intergenic
960217802 3:115064239-115064261 AAGACCAAGATAGAGGGTTCAGG - Intronic
960734756 3:120766573-120766595 AAGGAGAAGATGAAGGGGTAAGG - Intronic
960868066 3:122222141-122222163 CAAAACAAGATAAAGGGGACTGG + Intronic
961288969 3:125829903-125829925 AAGAATAAGATGTGGGGGTTTGG - Intergenic
962922440 3:139963248-139963270 AAGAAAAACAGGGAGGGGTCTGG - Intronic
963577474 3:147078892-147078914 AAGTACAAGATCAAGGCATCAGG - Intergenic
964466489 3:156998825-156998847 AAGAAAAAGATGAAGGAGAGAGG - Intronic
965790955 3:172387391-172387413 AAAAATATGATGAAGGGGACAGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968126598 3:196164513-196164535 AAATACAAGAGAAAGGGGTCAGG + Intergenic
968876535 4:3270586-3270608 AAGGACAAGAGGAAGGAGTGAGG - Intronic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
971744060 4:30556576-30556598 AAGATCAGGATGAAGGGGACAGG + Intergenic
973560678 4:52131957-52131979 AGGAACAAGATGAAGGAGATGGG + Intergenic
973677823 4:53284394-53284416 AAGAACAGAATGGTGGGGTCAGG + Intronic
973771341 4:54209879-54209901 AAGAACAGGAAGGAGGGGTCAGG + Intronic
976305959 4:83559789-83559811 AACAAAAAGATGAGGGGGGCAGG + Intronic
976728869 4:88243007-88243029 AATAACAAGATAAAGGGGTTTGG - Intergenic
976954362 4:90877270-90877292 AAAAACAAGATAAGGAGGTCAGG - Intronic
978268530 4:106858866-106858888 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
978792534 4:112677762-112677784 GAGAACAGGTTGTAGGGGTCAGG - Intergenic
980553975 4:134378731-134378753 AAGAAAAAGAAAAAGGTGTCTGG + Intergenic
981731940 4:147908830-147908852 AAAAATAAGATAAAGGGGGCAGG - Intronic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983307930 4:166017671-166017693 AAGAACAAGAGGAAGGGAGGGGG - Intronic
983519900 4:168697318-168697340 AAGGACAAGATGTAGAGGTGGGG + Intronic
984723005 4:182993772-182993794 AAAAGCAAAATGAAGGGGTGGGG - Intergenic
984846215 4:184110168-184110190 AAGAACAGAAAGAAGGGGTGAGG - Intronic
985443415 4:190002206-190002228 ATAAACAGAATGAAGGGGTCAGG - Intergenic
988494597 5:31734292-31734314 AACAACAAAATGACAGGGTCTGG - Intronic
989289637 5:39748245-39748267 AAGAAAAAAATGAAGGGGTGAGG - Intergenic
991918119 5:71625046-71625068 AAGACCAAGATGAGGGAGGCAGG - Intronic
992571242 5:78059996-78060018 AACAAAAACATGAGGGGGTCTGG + Intronic
995170036 5:109097580-109097602 AAGAACAAGTTGAAAAGGACAGG + Intronic
996241000 5:121201198-121201220 AAGAAGAAAAGAAAGGGGTCAGG - Intergenic
996555149 5:124770554-124770576 AAGAACAAAATGATGAGGCCAGG - Intergenic
997549190 5:134737640-134737662 AAAAACAAGGTGAAGGGGAATGG + Intergenic
997804637 5:136905085-136905107 AAGAGAAAGATGAAGGGGAAAGG - Intergenic
997940596 5:138153969-138153991 AAGAAAATGGTGATGGGGTCGGG - Intronic
999320466 5:150611732-150611754 AAGGACTAGAAGAAGGGATCGGG + Intronic
999347575 5:150838011-150838033 AAGAACAAAAAGATGGGGTGGGG - Intergenic
1000126010 5:158244888-158244910 AAGAACAATGGGAAGGGGTGAGG - Intergenic
1000690083 5:164306720-164306742 AAGTCCAAGATCAAGGTGTCAGG - Intergenic
1001007801 5:168069705-168069727 AGAAAGAAGATGAAGGTGTCTGG - Intronic
1001130024 5:169056098-169056120 AGGAACAAGATGAAGGGGCTCGG + Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002530191 5:179839836-179839858 AAGAACAAGACAAATGGGCCAGG + Intronic
1003150426 6:3543324-3543346 AAGTCCAAGATCAAGGTGTCAGG + Intergenic
1004512122 6:16291613-16291635 AAGAACCTGATGATGGGGCCAGG + Intronic
1005519139 6:26583360-26583382 AAAAACAATATTAAGGAGTCAGG - Intergenic
1005765265 6:29005267-29005289 AAGAATAAAAAGAATGGGTCAGG + Intronic
1006002202 6:30973989-30974011 AAGAAGAAGAAGAAGAGGCCGGG + Intergenic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1008200464 6:48581806-48581828 AAGTTCAAGATCAAGGTGTCAGG - Intergenic
1008294903 6:49763668-49763690 AAGGAGAAGTTGAAGGGGTAAGG - Intergenic
1009888135 6:69649267-69649289 AAGAACTAGACGAAGGCCTCAGG - Intergenic
1009894578 6:69732423-69732445 AAGTACAACATCAAGGTGTCTGG - Intronic
1011963754 6:93125806-93125828 AAGAACAGGATAAAGCTGTCAGG - Intergenic
1012181253 6:96155826-96155848 AAGTCCAAGATCAAGGGGTCAGG - Intronic
1012316510 6:97787509-97787531 AAGAACAAGAAGCGGGGGTGGGG + Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1015143043 6:129957738-129957760 AAGACCATGAGGAAGGGATCTGG - Intergenic
1015428093 6:133096026-133096048 AAGTACAAGATGAAGGGAGGTGG - Intergenic
1015885244 6:137911141-137911163 AAGAATAAGATGATTGGGTTGGG - Intergenic
1017169357 6:151441639-151441661 AACACCCAGATGATGGGGTCTGG + Intronic
1017598306 6:156053847-156053869 TAGGACAAGGTGAAAGGGTCAGG + Intergenic
1017649335 6:156566561-156566583 AAGACCAAGATGAAGAGGACCGG + Intergenic
1017798434 6:157869349-157869371 AAAAACTAGGTGAAGGTGTCTGG - Intronic
1018325297 6:162661263-162661285 AAAAAAAAGAACAAGGGGTCAGG + Intronic
1020666733 7:11053852-11053874 AAGAACAAGATGAAAGGAATGGG - Intronic
1020903095 7:14030297-14030319 AAGAACAAGGTGGAGGGAGCTGG + Intergenic
1022033447 7:26513100-26513122 GAGGGCAAGATGCAGGGGTCAGG + Intergenic
1022175035 7:27864410-27864432 AAGAAAAGGATGAAGGGGCCTGG - Intronic
1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG + Intronic
1023624281 7:42100741-42100763 AAGAAAAAGAAGAGGGGGTGGGG + Intronic
1023709056 7:42972643-42972665 AACAACATGATGAAGGAGCCAGG - Intergenic
1024273865 7:47661637-47661659 AAAAACAAGATGATGGGGAAAGG - Exonic
1024475467 7:49803953-49803975 AAGAACAAGATGACTGTGTTAGG + Intronic
1025791212 7:64688551-64688573 AAGAAGAGGAAGAAGGGGTTGGG - Intronic
1026154548 7:67815735-67815757 AAAAAGAAGAGGAAGGGGGCTGG + Intergenic
1028273721 7:88824632-88824654 AAGAAATAGATGAAAGGGCCAGG - Intronic
1029215541 7:98946385-98946407 AAGAGGGAGATGAAGGGGACTGG - Intronic
1031196010 7:118614686-118614708 AGGAACATGATGAAGAGGGCAGG + Intergenic
1031764762 7:125764096-125764118 AAAAGCAAGATGAATGTGTCAGG + Intergenic
1031867032 7:127048892-127048914 AAGAACAAAATCCAGGAGTCTGG - Intronic
1032350216 7:131155711-131155733 AAGTATAAAATGAAGGGGTTAGG - Intronic
1032957889 7:136993650-136993672 AAGAACATGATAATGGGGTTAGG + Intronic
1034009880 7:147518387-147518409 AAGCAGAAGATGAAGGAGACAGG + Intronic
1034189787 7:149205142-149205164 AAAAACAAAATGAAGAGGCCAGG + Intronic
1034944917 7:155255646-155255668 AAGAAGAAGAAGAAGGGGAAAGG + Intergenic
1034992119 7:155554567-155554589 AAGTCCAAGATCAAGGTGTCAGG + Intergenic
1036331767 8:7834902-7834924 AACAAAAAGATGAAGGGGAGAGG - Intergenic
1037283673 8:17272324-17272346 AAGAAAAAGATGAGGGGGAGAGG - Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1038638472 8:29305579-29305601 AAGAGCAAGCGAAAGGGGTCTGG - Intergenic
1039844051 8:41313166-41313188 AAAAAAAAGATGAAGAGGTAGGG - Intergenic
1040787270 8:51180457-51180479 AAGATAAGGAGGAAGGGGTCAGG - Intergenic
1040792106 8:51243542-51243564 GAGAACAAGATCAAAGGGCCTGG + Intergenic
1042164680 8:65934032-65934054 GAGAACAAAATGTAGGGGGCAGG + Intergenic
1042249018 8:66737603-66737625 AAAAAAAAGATAAAGGGGTCTGG - Intronic
1042950791 8:74198935-74198957 AAGAAAGAGATGACTGGGTCAGG - Intergenic
1043064666 8:75553338-75553360 TAGAACAAGGTGAATGGGTAAGG - Intronic
1043447673 8:80335073-80335095 AGGAATAAGATGAAGAGGTGGGG - Intergenic
1044471336 8:92572454-92572476 AATAACAAAATTAAGGGTTCTGG - Intergenic
1044604810 8:94039397-94039419 AGGAACAAGATAAAGGGGCGTGG + Intergenic
1044637823 8:94344172-94344194 AAGAAGAAAATTAAGGGGTGAGG + Intergenic
1044673875 8:94710366-94710388 AAAAAAAAAATGAAGGGATCTGG + Intergenic
1045846374 8:106641867-106641889 GAGAACAAGATGGATGGGTGAGG + Intronic
1046384176 8:113487145-113487167 CAGTACAGGATGAAGGGCTCTGG - Intergenic
1046573855 8:116000675-116000697 AAAAACAATATGAAGGGATCAGG + Intergenic
1047515151 8:125547420-125547442 AATAACAAGATGAAGGAATCTGG - Intergenic
1048683477 8:136873831-136873853 AAAAAGAAGATGAAAGGCTCAGG + Intergenic
1049431398 8:142566981-142567003 AAGAGGCAGATGAAGGGGGCGGG - Intergenic
1050406942 9:5319352-5319374 AAGAACAAGACGAATGGCTCAGG + Intergenic
1050413851 9:5394311-5394333 AAGAACAAGGTAAATGGCTCAGG + Intronic
1050445890 9:5722182-5722204 AAGAAGAAGATGAAATGGGCTGG - Intronic
1050741777 9:8828462-8828484 AAGTCCAAGATCAAGGTGTCAGG - Intronic
1050868888 9:10540316-10540338 AAGAACAATATGCCCGGGTCCGG - Intronic
1051141003 9:13978870-13978892 AAGAAAAAGAAGAAGGGGAGTGG - Intergenic
1051188213 9:14482449-14482471 AAGAACATGGTGAGGGGGTGAGG - Intergenic
1051662121 9:19435416-19435438 AGGAAAAAGAGGAAGGGGGCAGG + Intronic
1052374251 9:27699913-27699935 AAGAAAAAGAAGAAGGGATGTGG + Intergenic
1052407000 9:28073730-28073752 AAGAACATTTTGAAGGGGCCAGG + Intronic
1053282519 9:36830187-36830209 AAGTCCAAGATGAAGGTGTCAGG - Intergenic
1053417831 9:37957893-37957915 AAGAACAAGTTCAAGGGCCCTGG + Intronic
1053466139 9:38310082-38310104 AAGAACAGCAAGCAGGGGTCAGG - Intergenic
1056430995 9:86527615-86527637 AAGAACAAGAAGAAGAGGTTGGG + Intergenic
1056584402 9:87919063-87919085 AAAAACAGGAAGAGGGGGTCGGG - Intergenic
1056612465 9:88133844-88133866 AAAAACAGGAAGAGGGGGTCGGG + Intergenic
1057566369 9:96169264-96169286 AAAAACAAGATTAAGGGCCCAGG + Intergenic
1057682729 9:97205347-97205369 AAGCACAAGCACAAGGGGTCAGG + Intergenic
1058508069 9:105687006-105687028 AAGAATAAGATGGATGGGTGAGG - Intergenic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1059044075 9:110845245-110845267 AACAGCAAGATGAAGTTGTCAGG + Intergenic
1059357434 9:113710739-113710761 CAGAACAAGTTTGAGGGGTCTGG + Intergenic
1059949127 9:119443441-119443463 AAGAAAAAGAGAAAGGGGCCAGG + Intergenic
1060506485 9:124201898-124201920 AAAAACCAGATGACTGGGTCGGG + Intergenic
1060838504 9:126776484-126776506 AAGTCCAAGATGAAGGTATCTGG + Intergenic
1061231477 9:129318361-129318383 AAGACCAAGGTTCAGGGGTCAGG + Intergenic
1061306622 9:129736251-129736273 AAGCTCAAGGTGGAGGGGTCTGG + Intergenic
1061383282 9:130272534-130272556 AAGAAGAAGAAGAAGAGGCCAGG - Intergenic
1061581401 9:131538979-131539001 AAAAACAAGAGGAAGGGGCTGGG - Intergenic
1062129944 9:134886902-134886924 AAGAACAGGAGGCAGGGGTCAGG - Intronic
1062379397 9:136279975-136279997 AAGAACAAGATGCCGGTGTCTGG - Intergenic
1062387344 9:136318108-136318130 AAGAAAAAGATGGAGCCGTCAGG + Intergenic
1186217117 X:7312156-7312178 GGGAACAAGATGAAGGGGTTGGG - Intronic
1188435573 X:30154672-30154694 AAAAACATGATTAAGTGGTCAGG - Intergenic
1189379205 X:40489800-40489822 AGGACCAAGGTGAAGGGCTCTGG + Intergenic
1189512975 X:41682255-41682277 AAAAAGAAGGTGAAGGGGTCAGG + Intronic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189663596 X:43329040-43329062 AAAAAAAAGTTGAAGGGGTGAGG - Intergenic
1189895527 X:45651644-45651666 AAGAACCAGAGGAAGCAGTCGGG - Intergenic
1189906669 X:45767702-45767724 AACAACAAACTGAAGGGATCTGG - Intergenic
1190051960 X:47157130-47157152 CTGGACAAGATCAAGGGGTCTGG - Intronic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1190930840 X:54948688-54948710 AAGAAGGAGATGAAATGGTCTGG - Intronic
1192436461 X:71146274-71146296 AAGAACTGGCTGAAGGGGTGGGG - Intronic
1193906629 X:87253047-87253069 CAGATCAGGATGAAGAGGTCAGG - Intergenic
1193974197 X:88097597-88097619 AAAAACAAAATAAAGAGGTCGGG + Intergenic
1194885259 X:99307433-99307455 GAGAACTAGATGAAGAGCTCAGG + Intergenic
1194885296 X:99307949-99307971 AAGTACTAGATGGAGGGGTCAGG + Intergenic
1196497990 X:116345517-116345539 ATGAAAAAGATGAAAGGATCAGG - Intergenic
1198633524 X:138669680-138669702 AAGAACAAGGTGTGGGGGCCAGG - Intronic
1199684483 X:150254329-150254351 AAGATCAAGAAGCAGGGCTCTGG + Intergenic
1201587474 Y:15576918-15576940 GAGAACAAGATTAATGGGTTGGG - Intergenic