ID: 1117348731

View in Genome Browser
Species Human (GRCh38)
Location 14:54860020-54860042
Sequence TTGGGTATACACAGGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 5, 2: 35, 3: 122, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117348731_1117348738 5 Left 1117348731 14:54860020-54860042 CCAGGACCCCTGTGTATACCCAA 0: 1
1: 5
2: 35
3: 122
4: 359
Right 1117348738 14:54860048-54860070 GCATACTCAAGTCCCGCAGTCGG 0: 2
1: 28
2: 56
3: 114
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117348731 Original CRISPR TTGGGTATACACAGGGGTCC TGG (reversed) Intronic
901425029 1:9177093-9177115 TTTGGTATTCACAGGGATCCTGG - Intergenic
902975775 1:20087309-20087331 TTTGGTATTCACAGGGGTCCTGG - Intronic
904855081 1:33491643-33491665 TTGAGTCTACCCAGGGGCCCAGG + Exonic
905115585 1:35636815-35636837 TTGGGTATCTGCAGGGGTTCTGG + Intronic
906235589 1:44206419-44206441 TTGGGTATACATGGGGGTCCTGG + Intergenic
906467091 1:46091743-46091765 TTTGGTATCTGCAGGGGTCCTGG - Intronic
906639797 1:47434849-47434871 TTGGATAAACAGAGGGGTTCTGG + Intergenic
907118141 1:51987747-51987769 TTCGGTATATATGGGGGTCCTGG - Intronic
907444977 1:54501669-54501691 ATGGGTACACAGTGGGGTCCCGG - Intergenic
907749454 1:57248037-57248059 TTTGGTATCCACAAGGGTCCTGG - Intronic
907923569 1:58935159-58935181 TTGGGTATCCACAAGAGTCCTGG - Intergenic
909364360 1:74801988-74802010 TTGGCTAACCACAGCGGTCCTGG - Intergenic
910224009 1:84917907-84917929 TTTGGTTTCCACAGGGGTCCTGG + Intergenic
910567331 1:88658964-88658986 TTGGGTACATGCATGGGTCCAGG + Intergenic
911428339 1:97750861-97750883 TTTGGTATATGCAAGGGTCCTGG + Intronic
911662758 1:100522068-100522090 TTTGGTATCCGCAGAGGTCCTGG - Intergenic
914742656 1:150478258-150478280 TTTGGTATCCATGGGGGTCCTGG - Intergenic
914777776 1:150754018-150754040 TTTGGTATGCTCAGAGGTCCTGG - Intronic
915230434 1:154441801-154441823 TTTGGGAGACACAGAGGTCCTGG + Intronic
916033772 1:160902751-160902773 TTGGGTATCCATTGGGGTCTTGG - Intergenic
916481369 1:165217561-165217583 TTGAGTATATGCAGGGGTCCTGG - Intronic
916851409 1:168707980-168708002 TTTGGTATCCATGGGGGTCCTGG - Intronic
917016299 1:170534448-170534470 TTTGGTATACATGGGGATCCTGG + Intronic
917645254 1:177023419-177023441 ATTGGTGTTCACAGGGGTCCAGG + Exonic
917960501 1:180140623-180140645 TTGGGTATCTTCAGGGATCCTGG - Intergenic
918260778 1:182793959-182793981 TTTGGTATACACGAAGGTCCTGG + Intronic
918594011 1:186271746-186271768 TTTGATATCCACAGGGGTCCTGG - Intergenic
918852099 1:189705655-189705677 TATGGTATCCACACGGGTCCTGG + Intergenic
919353967 1:196497559-196497581 TTTGGTATCCACAGAAGTCCTGG + Intronic
919361055 1:196595487-196595509 TTTAGTATCCCCAGGGGTCCTGG - Intronic
919649098 1:200127829-200127851 TTGAGTATAGGCAGGGGTCCTGG + Intronic
919649119 1:200128117-200128139 TTTGGTATAAACAGGGGTGCTGG - Intronic
919841708 1:201614089-201614111 TTGGCTAAAAACAGAGGTCCTGG - Intergenic
920515176 1:206579983-206580005 TTGGCTACACACGGGGCTCCTGG + Intronic
921134349 1:212246821-212246843 CTGGGTATACACCAGGGGCCTGG + Intergenic
921384380 1:214553771-214553793 TTGGGCAGACACAAGGGTTCCGG + Intergenic
921998268 1:221445662-221445684 TTTGTTATCCACGGGGGTCCTGG - Intergenic
922671148 1:227509588-227509610 GTGGGTATGCCCAGGGGACCTGG - Intergenic
922773579 1:228204103-228204125 TTTGGTATATGCGGGGGTCCAGG + Exonic
922778612 1:228231181-228231203 TTTGGTATCTACAGGAGTCCTGG - Intronic
923093522 1:230757174-230757196 TTTGGTATACACAGGGGTCCTGG + Intronic
923202142 1:231723082-231723104 TTCTGTATCCACAGGCGTCCTGG - Intronic
923365869 1:233260047-233260069 TTTGTTATCCACGGGGGTCCTGG + Intronic
923424622 1:233856349-233856371 TTTGGCATACGCAGGGGGCCTGG + Intergenic
923633045 1:235667570-235667592 TTTGATATCCTCAGGGGTCCTGG - Intronic
924192528 1:241568902-241568924 TTTTGTATCCACAGGGGTCCTGG - Intronic
1063558531 10:7104172-7104194 TTTGATATCCACAGGGGACCTGG + Intergenic
1063648527 10:7909886-7909908 CTGGGTATCTGCAGGGGTCCTGG - Intronic
1063906129 10:10782108-10782130 TTTGGTATTCATGGGGGTCCTGG + Intergenic
1064080890 10:12307172-12307194 TTGGGTATAGAAATGGATCCAGG + Intergenic
1064572183 10:16705271-16705293 TTTGACATCCACAGGGGTCCTGG - Intronic
1065541545 10:26774040-26774062 TTTGGTATCCATGGGGGTCCTGG - Intronic
1065575914 10:27118052-27118074 TTTGGTATCCACATGGGTCCTGG + Intronic
1065744234 10:28824710-28824732 TTTGGAATCCACGGGGGTCCTGG + Intergenic
1066430762 10:35349132-35349154 TTTGGTATCTGCAGGGGTCCTGG + Intronic
1067164216 10:43852437-43852459 TTTGATATACTCGGGGGTCCTGG - Intergenic
1067938189 10:50629118-50629140 TTTGGTGTCCTCAGGGGTCCTGG - Intergenic
1068406752 10:56599543-56599565 TTTAGTATCCACAGGGGCCCTGG - Intergenic
1068451404 10:57194282-57194304 TTGGGTATATGCAGGAGTCCTGG + Intergenic
1068455990 10:57254751-57254773 TTTGGTATCAACAGGGTTCCTGG - Intergenic
1068464474 10:57371140-57371162 TTTGGTATCCACAGGGATCCTGG + Intergenic
1069168817 10:65199137-65199159 TATGGTATCCACAGGGGTCTGGG + Intergenic
1069243723 10:66174723-66174745 TTTGGTAAACATGGGGGTCCTGG + Intronic
1069923578 10:71832636-71832658 TTGGGTGTCCATGGGGGTCCTGG - Intronic
1070095991 10:73338865-73338887 TTTGGTATTTGCAGGGGTCCTGG + Intronic
1070632556 10:78097052-78097074 GTCAGTATACACAGGGGTCAGGG - Intergenic
1072905210 10:99446720-99446742 TTTGGTATCTGCAGGGGTCCTGG + Intergenic
1073640171 10:105244496-105244518 TTTTGTATACACAGCGGTCCTGG + Intronic
1073789508 10:106925912-106925934 TTGTTTATACACAGTTGTCCAGG - Intronic
1074076285 10:110128917-110128939 CTGGGTATACACAGAGCTCGGGG + Intronic
1074464570 10:113669839-113669861 TTTGGTATCCTCAGGGGCCCTGG - Intergenic
1075503805 10:123003415-123003437 TTTGCTATCTACAGGGGTCCTGG + Intronic
1075507884 10:123041844-123041866 TTTGGTATCCATGGGGGTCCTGG + Intronic
1077265148 11:1644963-1644985 GTGGGGAGACACAGGTGTCCAGG - Intergenic
1078539972 11:12205481-12205503 TTTGGCATACTCAGGGGTTCTGG + Intronic
1078563603 11:12394723-12394745 CTGGGTATACACAGGGGTCCTGG - Intronic
1078808486 11:14732675-14732697 TTGGATATACTCAAGAGTCCTGG - Intronic
1079556599 11:21765966-21765988 TTTGGTATTTACAGGGATCCTGG - Intergenic
1080413587 11:32049340-32049362 TTGGGTATCTGTAGGGGTCCTGG + Intronic
1081178244 11:39955318-39955340 TTTGGTATCCACAGGGGTCTTGG + Intergenic
1081301881 11:41462673-41462695 TTTGATACACAGAGGGGTCCTGG + Intergenic
1081952441 11:47056080-47056102 TTTGGTATAAACAGGGGTCCTGG - Intronic
1081994680 11:47355610-47355632 TTGCGTACGCACAGGGGCCCGGG + Intronic
1082754775 11:57063451-57063473 TTGGGGCTACTCAGGGGTCAAGG - Intergenic
1084674676 11:70627186-70627208 TTGGGCACACACAGGGCTGCAGG + Intronic
1085373727 11:76038555-76038577 TTTGGCATCCACAAGGGTCCTGG + Intronic
1087332368 11:96797101-96797123 TTGGGTATACTTAGGGGTCCTGG - Intergenic
1087853447 11:103060536-103060558 TTGGGTATACACAAGGGTCCTGG + Intergenic
1087963565 11:104383430-104383452 TTTAGTATCCATAGGGGTCCTGG + Intergenic
1087997282 11:104825177-104825199 TTTGGTATTCACAGGGGTTCTGG + Intergenic
1088327831 11:108619271-108619293 TTGGGGATTTGCAGGGGTCCTGG - Intergenic
1089029592 11:115311404-115311426 TTTGGTATATGCAGAGGTCCTGG - Intronic
1089049308 11:115532771-115532793 TTGAGTATACCCAGGGGTCCTGG + Intergenic
1090782361 11:130018869-130018891 TTTGGTACCCACAGGTGTCCTGG + Intergenic
1091364426 11:135005707-135005729 TTTGGTATCCCCAGGGGTCCTGG - Intergenic
1091812787 12:3413941-3413963 TTTGGTATTCACAGGTGTCCTGG + Intronic
1092699000 12:11205845-11205867 TTTGGTATCCACAGGGGTCATGG + Intergenic
1092893335 12:12989944-12989966 TTTGGTATCCATAGAGGTCCTGG - Intronic
1093836468 12:23835949-23835971 ATGGCTATACACAGGAGCCCTGG + Intronic
1094190228 12:27690278-27690300 TTTGGTATACATGGGGGTCTTGG + Intronic
1094461555 12:30701924-30701946 TTGGGTATACATGGATGTCCTGG - Intergenic
1094481149 12:30882508-30882530 TTTGGTATGCACAGGGGTCCTGG - Intergenic
1095235678 12:39792616-39792638 TTTGGTATCCACAGGGATCCTGG - Intronic
1096002605 12:48141910-48141932 TTAGGCTTACACAGGGGGCCTGG + Exonic
1097343061 12:58461512-58461534 TTTGGTATCCACAGAGGTCCTGG - Intergenic
1097752982 12:63378383-63378405 GTCAGTATACACAGGGGTCAGGG - Intergenic
1098450870 12:70616893-70616915 TTGGTTATACATAAGGGTCCTGG - Intronic
1101390855 12:104298967-104298989 TTGGGTATACACAAGGGTCCTGG - Intronic
1101601189 12:106211916-106211938 GTCAGTATACACAGGGGTCAGGG + Intergenic
1101629899 12:106483090-106483112 TTGAATATATGCAGGGGTCCTGG - Intronic
1102008155 12:109601903-109601925 TTGGGGGTACAGAGGAGTCCCGG - Intergenic
1103048806 12:117761328-117761350 GTGGGTGTACACAGGGGCCCCGG + Exonic
1103284751 12:119791346-119791368 TTGGGTATCCAGAGCTGTCCTGG - Intronic
1104450572 12:128865189-128865211 TTGGGAGTTCACAGGGGTCTGGG - Intronic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1105816454 13:24040583-24040605 CCGGGGAGACACAGGGGTCCAGG + Intronic
1106210625 13:27640811-27640833 TTTGGTATCCATGGGGGTCCTGG - Intronic
1106669574 13:31890141-31890163 TTTGGTATCTGCAGGGGTCCTGG + Intergenic
1107067947 13:36236861-36236883 TTTGGTATCCATGGGGGTCCTGG - Intronic
1107774857 13:43827731-43827753 TTTGTTACACATAGGGGTCCTGG + Intronic
1109481511 13:62961548-62961570 TTTGGTATCCACAGGAGTCCTGG + Intergenic
1111682683 13:91463079-91463101 TTGGGTATTCAAGGGGGTCCTGG - Intronic
1112269363 13:97954141-97954163 TTGTGCCTACACATGGGTCCTGG - Exonic
1112539262 13:100291367-100291389 TTTAGTATTCACAGGGGTCCTGG + Intronic
1113546538 13:111155151-111155173 TTTGGTATCCACCGGGATCCTGG + Intronic
1113781238 13:112978878-112978900 CTGGGCACACACAGGGCTCCAGG - Intronic
1114302245 14:21388825-21388847 TTTGGTATCTGCAGGGGTCCTGG + Intronic
1114480456 14:23030569-23030591 TTTGGTATATGCAGGGGTCTTGG - Intronic
1115929425 14:38474349-38474371 TTTGGTATCTGCAGGGGTCCTGG - Intergenic
1116884475 14:50206350-50206372 TTGGGTATCCACAGGTGTCCTGG - Intronic
1116976565 14:51123026-51123048 TTTGGTATTCACAAGGGTCCTGG + Intergenic
1117348731 14:54860020-54860042 TTGGGTATACACAGGGGTCCTGG - Intronic
1118135113 14:63015664-63015686 TTTGATATACGCAGGGATCCTGG - Intronic
1118530400 14:66698748-66698770 TTTGGTATATGCAGAGGTCCTGG - Intronic
1119430045 14:74560930-74560952 TTTGGTATTCACAGGGGTCCTGG + Intronic
1119957813 14:78819538-78819560 TTTGGTATTCACAAGGGTCCTGG + Intronic
1120041172 14:79754429-79754451 TTTTGTATCCACAGGGGTCCTGG + Intronic
1120696025 14:87646519-87646541 TTAGGTATCCACAGGTCTCCTGG - Intergenic
1122943051 14:104991630-104991652 TTGGGTTGACACAGGGCTCCTGG + Intronic
1123879538 15:24663956-24663978 TTTGGTATTCACAGGGGTTCTGG - Intergenic
1124225621 15:27891461-27891483 TTTGGTATCCACAGAGGTCCTGG - Intronic
1124913679 15:33947521-33947543 TTTGGTATCCTCAGGGGTTCTGG - Intronic
1125742545 15:41976344-41976366 TTTGGTATTCCCAGGGGTCCTGG + Intergenic
1126701658 15:51373252-51373274 TTTGGTATTCACAGGTGTCCTGG - Intronic
1127158103 15:56150339-56150361 GTCAGTATACACAGGGGTCAGGG - Intronic
1127318852 15:57823048-57823070 TTTGGTATCCATAGGAGTCCTGG + Intergenic
1129634966 15:77305700-77305722 TTTAGTGTTCACAGGGGTCCTGG - Intronic
1131451123 15:92541031-92541053 TTTGGTATCTGCAGGGGTCCTGG + Intergenic
1131754829 15:95548546-95548568 TTTGGTATCTGCAGGGGTCCTGG - Intergenic
1133774044 16:8884258-8884280 TTGAGAAGCCACAGGGGTCCTGG + Intergenic
1134467715 16:14494157-14494179 TTTGGTATACTCAGGGGTCCTGG + Intronic
1135577226 16:23595390-23595412 TTGGGTATAGTCGGGGGTCCTGG - Intronic
1136412465 16:30085400-30085422 TTGGGAATGCACAGGGTTGCTGG + Intergenic
1136634749 16:31513466-31513488 TTGCGTATACTCCAGGGTCCTGG - Intergenic
1138026510 16:53526410-53526432 TTTGGTAAACTTAGGGGTCCTGG - Intergenic
1139075279 16:63439178-63439200 TTTGGTATCCACAGAGGTCCTGG + Intergenic
1140768809 16:78184403-78184425 TTATTTCTACACAGGGGTCCTGG - Intronic
1141038741 16:80653835-80653857 TTGCGTGTACACAGGGATCATGG + Intronic
1143119162 17:4596591-4596613 TGGGGAATAAACAGGGGACCTGG + Intronic
1143611976 17:8023412-8023434 TTTGGTATCCAAGGGGGTCCCGG + Intergenic
1143992363 17:10977001-10977023 TTTGGTATACTCAGACGTCCTGG - Intergenic
1144513278 17:15895902-15895924 CTTGGTTTACACAGGGGTCTTGG - Intergenic
1144819014 17:18058321-18058343 TTTGGTATTCATGGGGGTCCTGG + Intronic
1145357290 17:22171207-22171229 TTTGGTATCCACAGGGGTCCTGG - Intergenic
1146776966 17:35628236-35628258 TTTGGTATCCACAGGGGCCCAGG + Intronic
1146832625 17:36082742-36082764 TTGGGTAACCACAGGGCTCAGGG + Intergenic
1146847108 17:36189046-36189068 TTGGGTAACCACAGGGCTCAGGG + Intronic
1147859593 17:43510411-43510433 TTTGGTATCCTCGGGGGTCCTGG - Intronic
1148601333 17:48896369-48896391 TGTGGTATCCACTGGGGTCCTGG + Intergenic
1148657777 17:49301082-49301104 TTAGGTATAAGAAGGGGTCCTGG - Intronic
1149147535 17:53514176-53514198 TTTGCTATCCACGGGGGTCCTGG - Intergenic
1149275613 17:55031696-55031718 TTGGGTATATGCAGGGGTCCGGG - Intronic
1149398130 17:56265651-56265673 TTTGGTATCCATGGGGGTCCTGG - Intronic
1149739009 17:59025563-59025585 TTTAGTATACGCAGGGGTCCTGG - Intronic
1150244945 17:63667589-63667611 CTTGGCATCCACAGGGGTCCTGG - Intronic
1150535411 17:66034072-66034094 TTTGATATACACAGAGGTCCTGG + Intronic
1151295961 17:73186385-73186407 TTGGAGATATACAGGGGTCCTGG + Intergenic
1151438081 17:74110695-74110717 ATGTGTATACACAGGGCCCCTGG + Intergenic
1151636583 17:75353237-75353259 TTGGGTATATGCAGGGGTCCTGG - Intronic
1153123906 18:1766142-1766164 TTTGGTATCCATGGGGGTCCTGG + Intergenic
1153206871 18:2712594-2712616 TTTGGTATACATGGGGATCCTGG + Intronic
1153526276 18:5997909-5997931 TTTGGTATCCATGGGGGTCCTGG + Intronic
1153753091 18:8253577-8253599 TTGGACATATACTGGGGTCCTGG - Intronic
1153773135 18:8431367-8431389 TTTGGTATCCTCAGGGGTCCTGG - Intergenic
1154046862 18:10914377-10914399 TTTGGGGTCCACAGGGGTCCTGG - Intronic
1154174795 18:12078649-12078671 TTTGGGGTCCACAGGGGTCCTGG + Intergenic
1154281406 18:13006457-13006479 TTTGGTACATGCAGGGGTCCCGG + Intronic
1154373810 18:13791992-13792014 TTTGGTATCCTCAGAGGTCCTGG + Intergenic
1155326062 18:24666043-24666065 GTGGGTAGACATAGGGATCCAGG - Intergenic
1156131334 18:33978643-33978665 TTTGGTATCAGCAGGGGTCCTGG - Intronic
1156814914 18:41298189-41298211 TTTGGCATCCACGGGGGTCCTGG - Intergenic
1157157048 18:45278627-45278649 TTTGGTATACTTAGGGGTCCTGG - Intronic
1157672668 18:49543388-49543410 TTTGGTATACACAGGGGGTCTGG + Intergenic
1157688613 18:49663159-49663181 TTTGGTATCCTCAGGGATCCTGG + Intergenic
1158657633 18:59353790-59353812 TTTGGTATCCACAGGGGTCCTGG - Intronic
1158884888 18:61817611-61817633 TTTGGTATACATGGGGGTCCTGG + Intronic
1159578366 18:70206611-70206633 TTGGGTATCTGCGGGGGTCCTGG - Intergenic
1161241686 19:3226596-3226618 TTGGGTGTACCCAGGGGTGGGGG - Intronic
1163559856 19:18012688-18012710 TTTGGTATCCACGGGGTTCCTGG + Intronic
1165314795 19:35048239-35048261 GTGGCTGTACACAGGGGACCTGG + Intronic
1165544798 19:36526198-36526220 TTTGGTATCCACAGTGATCCTGG - Intronic
1166593251 19:44020745-44020767 TTTGGTATATACAGAGCTCCTGG + Intergenic
1167232891 19:48296651-48296673 TGGGGGATCCACAGGGGGCCAGG + Exonic
1167868188 19:52345174-52345196 TTTGGTATCCTCAGGGGTCGTGG - Intronic
1168101847 19:54145493-54145515 TTGGGTCTCCACAGGGGTCAGGG + Intronic
1168254883 19:55159782-55159804 TTGCTTAGACCCAGGGGTCCAGG - Intronic
925187399 2:1858585-1858607 TTTGGTATCCTCAGGGGTCCTGG + Intronic
926266325 2:11325291-11325313 TTTGGTATCCACAGGGGTCTTGG + Intronic
926488799 2:13498313-13498335 TTTGGTATCTTCAGGGGTCCTGG - Intergenic
927101695 2:19792481-19792503 TTGGGTATACTCCAGGGTCCTGG + Intergenic
927537264 2:23873394-23873416 TTTGGTATTCGCAAGGGTCCTGG - Intronic
927745052 2:25611459-25611481 TTTGGTATCTGCAGGGGTCCTGG - Intronic
928011630 2:27613558-27613580 TTGGGTATTCACAGAGGTCCTGG - Intronic
928109050 2:28491816-28491838 TTGGAAATACACAGGAGCCCTGG + Intronic
928553042 2:32392820-32392842 TTTGGTAGACACAGGGTTTCTGG + Intronic
928716562 2:34067881-34067903 TTTGGTATCCATAGGGGTCCTGG + Intergenic
929098668 2:38287685-38287707 TTTGGTATCCACAGGGATCCTGG - Intergenic
929165059 2:38873960-38873982 TTTGGTATACATGGGGGTTCTGG - Intronic
929210447 2:39351124-39351146 TTTGGTATCCACTGGGGTTCCGG + Intronic
929214232 2:39393744-39393766 TTTGGTACACTCAAGGGTCCTGG - Intronic
929323166 2:40571114-40571136 TTTGATATCCACTGGGGTCCTGG + Intronic
929849010 2:45564886-45564908 TTGGGTATATGCAGGGATCCTGG + Intronic
930661053 2:54053541-54053563 CTGGGTGTACACAGGGGGACTGG - Intronic
931492170 2:62760012-62760034 TTCAGTATACACAGGGGTCCTGG - Intronic
931498179 2:62834883-62834905 TTTGGTATAGACAGGGTTCCTGG + Intronic
931792604 2:65678154-65678176 TTGGTTATCTGCAGGGGTCCTGG - Intergenic
932065701 2:68557109-68557131 TTTGGTATGCCCTGGGGTCCTGG - Intronic
932675214 2:73774469-73774491 TTGGGTATAGACAGTGGTGATGG - Intronic
932880210 2:75494320-75494342 TGGGGTAAACACAGGGATGCTGG + Intronic
933127679 2:78630998-78631020 TTTGGCATCCACAGGGGTCCTGG + Intergenic
933421326 2:82049134-82049156 TTTGATATACACAGGGGTCCTGG + Intergenic
933917686 2:87012911-87012933 TTTGGTAGCCACAGGGGTCCTGG + Exonic
934005310 2:87757006-87757028 TTTGGTAGCCACAGGGGTCCTGG - Exonic
934535974 2:95133814-95133836 TTTGGTATCTACAGGGATCCTGG + Intronic
935265277 2:101387995-101388017 TTTGGTATCCACGGGGGTCCTGG - Intergenic
935708278 2:105875296-105875318 TTTGCTCTACACAGGGGCCCTGG - Intronic
935768269 2:106391093-106391115 TTTGGTAGCCACAGGGGTCCTGG - Intergenic
936412175 2:112270190-112270212 TTTGGTATATGCAGGGGTCTTGG + Intergenic
936448269 2:112614421-112614443 GTCAGTATACACAGGGGTCAGGG + Intergenic
936451333 2:112635973-112635995 TGGGGTGTACACAGGTGTCAGGG + Intergenic
937089538 2:119196753-119196775 TTGGAAAGACACAGGGGTCCTGG - Intergenic
937139601 2:119588309-119588331 GTGGGTACAGACAGGAGTCCAGG + Intronic
937380130 2:121368911-121368933 TTGGGTATACATAGTGGTGATGG - Intronic
938752585 2:134347739-134347761 TTTGGTGTCCACAGGGGTCCTGG + Intronic
939574758 2:143882852-143882874 TTGAGTATACATGGGGGTCCTGG - Intergenic
940297231 2:152140025-152140047 TTTGGTATCAACAGGGGTTCTGG + Intronic
940782736 2:157950343-157950365 TTTGGTATCCTCGGGGGTCCTGG + Intronic
941066097 2:160904496-160904518 TTGGGTAGCCATGGGGGTCCTGG - Intergenic
941730235 2:168909203-168909225 ATGTATATACACACGGGTCCAGG + Intronic
942083267 2:172421717-172421739 TTGGTTATGTGCAGGGGTCCTGG + Intergenic
943024035 2:182607465-182607487 TTTGGTATACGCGGGGGTTCTGG - Intergenic
943197166 2:184768292-184768314 TTTGGTATCTGCAGGGGTCCTGG + Intronic
944247386 2:197545222-197545244 TTTGGTATTCATGGGGGTCCTGG - Intronic
944850881 2:203717745-203717767 TTTGGTATCTGCAGGGGTCCTGG + Intronic
945344500 2:208696950-208696972 GTTGGTATCCACAGGGTTCCTGG - Intronic
946078219 2:217093497-217093519 TTTGGTATCCACAGGGGTCCTGG - Intergenic
946087663 2:217190380-217190402 TTCGGTATTCAATGGGGTCCTGG - Intergenic
946519514 2:220449779-220449801 TTTGCTATGCACGGGGGTCCTGG - Intergenic
947164227 2:227245494-227245516 TTTGGTATTCATAGGGGTCCTGG + Intronic
947265802 2:228279030-228279052 TTTGATATACACAGGGGTCCTGG + Intergenic
947856486 2:233327911-233327933 TTGGGTATAGACAGCGGTGAAGG - Intronic
1168772384 20:423689-423711 TTGGGTATCTGCAGGGGTCTTGG + Intronic
1168989838 20:2085670-2085692 TTGGGTATTTTCAGGGGTTCTGG + Intergenic
1170446835 20:16436951-16436973 TTTGGTATCCTCAGGAGTCCGGG - Intronic
1172056263 20:32156421-32156443 TTTGGTATCTTCAGGGGTCCTGG - Intronic
1172580401 20:36042909-36042931 TTGGGTATACCCAGGGATTCTGG + Intergenic
1173682744 20:44897621-44897643 TTTGGTATCCCCAGGTGTCCTGG - Intronic
1175301060 20:57943098-57943120 TTAGGAATACCCAGGGGTCCCGG + Intergenic
1176074762 20:63243419-63243441 CTGGGTGTGCCCAGGGGTCCTGG - Intronic
1176701456 21:10056575-10056597 TTTGGTATCCTCTGGGGTCCTGG - Intergenic
1177362649 21:20093475-20093497 TTGAATATAGGCAGGGGTCCTGG - Intergenic
1178893468 21:36540176-36540198 TTTGGAATCCTCAGGGGTCCTGG - Intronic
1179013073 21:37571496-37571518 TTTGGTATCCCCAGGGGTCCTGG - Intergenic
1179264494 21:39791029-39791051 TTTGGTATCTGCAGGGGTCCTGG + Intronic
1180259087 21:46654813-46654835 TTGAATATCCACGGGGGTCCTGG + Intronic
1180683468 22:17646082-17646104 TTTGGTATCCACAGGTATCCTGG + Intronic
1180757140 22:18169996-18170018 TTTGGTAAAAGCAGGGGTCCTGG - Intronic
1181074638 22:20367469-20367491 TTTGGTAAAAGCAGGGGTCCTGG + Intronic
1182855543 22:33514647-33514669 TTTGGTATCCACGGGGTTCCTGG + Intronic
1182913875 22:34010172-34010194 TGTGGTATACACAGGGATCCTGG + Intergenic
1184009216 22:41734235-41734257 TTTGGTATCTTCAGGGGTCCTGG + Intronic
1184630309 22:45772825-45772847 TTTGGTAGCCACAGGGGTCCTGG - Intronic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949914239 3:8945161-8945183 TTTGGTATTCTCAGGGGTCCTGG + Intronic
950010461 3:9719251-9719273 TTTGGTATCCACAGGAGTCTTGG + Intronic
950451566 3:13068397-13068419 TTGGGTATACAACGGGGAGCAGG + Intronic
950777547 3:15363645-15363667 TTTGGTGTACTCAGGGGTCCTGG - Intergenic
950974441 3:17225994-17226016 TTTGGTATCCGCAGGGGTCCTGG + Intronic
951104452 3:18726752-18726774 TTTGGTATACATGGGGGTCCTGG - Intergenic
952386855 3:32848053-32848075 TTTGGTATCCAAGGGGGTCCTGG + Intronic
953662790 3:44903239-44903261 TTGGGTATACTCAGGGGTCCTGG + Intronic
954223330 3:49167507-49167529 CTGCTTATACAGAGGGGTCCAGG + Intergenic
955966498 3:64394312-64394334 TTTGGTATCCCCAGGGGTCCTGG + Intronic
956263922 3:67376761-67376783 TTGGGTAGACCCAGGGTCCCAGG - Intronic
956735825 3:72237374-72237396 TTTGGCATACATGGGGGTCCTGG - Intergenic
956828175 3:73018339-73018361 TTTGGTATACACAGGAGTCTTGG + Intronic
957174746 3:76792363-76792385 TTTGGTATCCTCGGGGGTCCTGG + Intronic
958121278 3:89292432-89292454 TTTGGCATCCACAGGGGTCCTGG + Intronic
958123569 3:89326176-89326198 TTTGGTATCCTCAGGGGTCCTGG - Intronic
959632579 3:108524791-108524813 TGGGGTATACATAGGAGCCCTGG - Intronic
959853174 3:111114933-111114955 TTGGGTATACTCAGGGACACTGG + Intronic
960496032 3:118376151-118376173 TTTGGTATTCATGGGGGTCCTGG + Intergenic
960576351 3:119233549-119233571 TTGGGTAGATGCAGGGGTCCTGG + Intronic
960589142 3:119348539-119348561 TTTGGTATCCATGGGGGTCCTGG - Intronic
960914418 3:122681511-122681533 TTGGAGATTCCCAGGGGTCCCGG + Intronic
961101649 3:124204021-124204043 TTTGGTATACGCGGAGGTCCTGG + Intronic
961140006 3:124547766-124547788 TTTGGTATACATAGGGGTAAGGG - Intronic
961409579 3:126708948-126708970 TTTGGTATCCATGGGGGTCCTGG - Intronic
962068187 3:132005667-132005689 TTGGGTATATGTGGGGGTCCTGG - Intronic
962406147 3:135101863-135101885 TTGTGTGCACACAGGGGACCAGG - Intronic
963364793 3:144321188-144321210 TCTGGTACAGACAGGGGTCCTGG - Intergenic
964365907 3:155950687-155950709 TTTGGAATACACGGGAGTCCTGG + Intergenic
964504937 3:157388893-157388915 TTTGGTATCCACGGGGGTTCTGG + Intronic
965099075 3:164273834-164273856 CTGGTTATACACATGGGTGCTGG - Intergenic
966053178 3:175647722-175647744 TTAGGTTTATACAGGGCTCCAGG - Intronic
966391603 3:179458557-179458579 TTTGGTATCCGCGGGGGTCCTGG - Intergenic
966545858 3:181147174-181147196 TTTGGTATCCACAGGGGTCCTGG + Intergenic
967701793 3:192601704-192601726 TTTGGTATCCACAGGGGTTCTGG - Intronic
968322705 3:197785260-197785282 TTGGGTATATACAAGGGTCCTGG - Exonic
971238425 4:24864941-24864963 TTTGGTGTACACGGGGTTCCTGG + Intronic
971291763 4:25348705-25348727 TTTGGTATATGCAGGGGTCCTGG + Intronic
972011348 4:34186542-34186564 TTTGGTATCCTCAGGGGTTCTGG + Intergenic
972268805 4:37489055-37489077 TTTGGTATACGCAGAGGTCCTGG + Intronic
972639305 4:40911272-40911294 TCTGGTATACTCGGGGGTCCTGG + Intronic
972942362 4:44212409-44212431 TTTGGTATATGCAGGGGTCTTGG - Intronic
973237965 4:47926483-47926505 TTGGGTATACATGGGGATCCTGG + Intronic
973535410 4:51876770-51876792 TTGGGTATAGGTGGGGGTCCTGG + Intronic
973734193 4:53854205-53854227 TTTGGTATCCTCAGAGGTCCTGG + Intronic
974318653 4:60315007-60315029 TTGGGTATACATGGGGCTCCTGG - Intergenic
974536042 4:63177082-63177104 TTTGGTATATAAGGGGGTCCTGG + Intergenic
975777611 4:77805109-77805131 TTAGGCATACACAAGGGTCATGG + Intronic
976284758 4:83360708-83360730 TTTGGTATCCATGGGGGTCCTGG - Intergenic
976426238 4:84906562-84906584 TTTGGTATACGTGGGGGTCCTGG - Intronic
977052952 4:92152801-92152823 TTTGGTATATACAAGGGTCTGGG - Intergenic
977366414 4:96074401-96074423 TTCAGTATTCACAGGGGTCTTGG + Intergenic
977664358 4:99628366-99628388 TTTAGTACCCACAGGGGTCCTGG - Intergenic
979572460 4:122244292-122244314 TTTGGTATCCACAGGTGTTCTGG - Intronic
979643221 4:123034247-123034269 TTTGGTATTCACAGTGGTCCTGG + Intronic
979744034 4:124187355-124187377 TTTGGTATCCATGGGGGTCCTGG - Intergenic
979964418 4:127060902-127060924 TTTGGTATATTCAGGGGTCCTGG + Intergenic
980783843 4:137527215-137527237 TTTGATATCCACAGGGGGCCTGG - Intronic
981278038 4:142924380-142924402 TTGGCTGTACAAAGGGGTTCAGG + Intergenic
981717497 4:147765938-147765960 TTGGGTATTCAAGGGGTTCCTGG - Intronic
982200170 4:152952710-152952732 TTTGGTATCCCCAGGGGTCCTGG + Intronic
982267538 4:153552455-153552477 TTTGGTATCCATGGGGGTCCTGG - Intronic
982381499 4:154753929-154753951 TTGGGTGTACATGGGGGTCCTGG + Intergenic
982411908 4:155087066-155087088 TTGAGTATGTACAAGGGTCCTGG + Intergenic
982813186 4:159852586-159852608 ATGGGTATACACAGTGATTCAGG + Intergenic
983153799 4:164319337-164319359 TTTGGTATCCACAGGGGTCCTGG + Intronic
983200221 4:164853013-164853035 TTTGGTATCCATGGGGGTCCTGG - Intergenic
984591312 4:181620337-181620359 TTGGGTATACGCGGGTGTCCTGG - Intergenic
984843813 4:184093167-184093189 CTGGGTATACACAGTGTTCCAGG - Intronic
985192000 4:187384484-187384506 TTTGGTATACACAGGGCTCCTGG - Intergenic
986147967 5:5097893-5097915 TTTGGTATCCACTGGAGTCCTGG + Intergenic
986639585 5:9858950-9858972 TTGGGTATACAAAGTGGTATTGG + Intergenic
986743938 5:10727777-10727799 TGTGGTATCCACAGGGGTGCTGG - Intronic
988268128 5:28978217-28978239 TTAGGAATACACAGGGGACAAGG - Intergenic
989126094 5:38053613-38053635 TTTGGTGTCCTCAGGGGTCCTGG - Intergenic
989774353 5:45184865-45184887 TTTGGTATCTGCAGGGGTCCTGG - Intergenic
991701700 5:69322403-69322425 AAGGAAATACACAGGGGTCCTGG - Intronic
991724188 5:69519749-69519771 TTGGGTATACATGGGGGTCCCGG - Intronic
992063338 5:73079831-73079853 TAGTATATACACAGGGGTCCTGG + Intronic
992710700 5:79452030-79452052 TTTAGTATACATAGGGGTCCCGG - Intronic
993850914 5:93007749-93007771 TTTGGTATTCGCAGTGGTCCTGG + Intergenic
994628265 5:102249313-102249335 TTGGGTATATGCAGGGGTCCGGG + Intronic
995134282 5:108663726-108663748 TTTGGTATCTGCAGGGGTCCTGG - Intergenic
995166340 5:109046884-109046906 TTCTGTATCCACGGGGGTCCTGG + Intronic
995346768 5:111130195-111130217 TTTGGTATCCACAGGGGTCCTGG - Exonic
995396014 5:111687916-111687938 TTTGGTATTCACAGGGGTCCTGG + Intronic
995764158 5:115597714-115597736 TTTGGTATATGCAGGGGTCCTGG - Intronic
996114842 5:119606595-119606617 TTGGGTATAAAGTGGTGTCCTGG - Intronic
996685096 5:126270982-126271004 TTGGGTATTGACAGTGGTCATGG + Intergenic
996988508 5:129598808-129598830 TTGGGGATATGCAGAGGTCCAGG - Intronic
997352556 5:133241439-133241461 CTGGGTATACACAGAGGCCCAGG + Intronic
999209796 5:149877928-149877950 TTTGGTATACTAGGGGGTCCTGG + Intronic
999526988 5:152417477-152417499 TTTGGTATCCACTAGGGTCCTGG - Intronic
1001006326 5:168053735-168053757 TTTGGTATCCACAGGGGTCCTGG + Intronic
1002711490 5:181197831-181197853 TGGGGTGTATACAGGGGACCAGG - Intronic
1003363344 6:5449928-5449950 TTTGGTATACTCAGGAGTCCTGG - Intronic
1003821801 6:9906530-9906552 ATGTGAATACACAGGGTTCCAGG + Intronic
1003987307 6:11449687-11449709 TTTGGTATCCATGGGGGTCCTGG - Intergenic
1004083678 6:12422279-12422301 TTTGGTATATGCAGGGGTCCTGG + Intergenic
1004464270 6:15869585-15869607 TTTGGTATCTGCAGGGGTCCTGG + Intergenic
1004876137 6:19956810-19956832 TTGGGTAAAAACAGGGGAGCAGG + Intergenic
1006015166 6:31075053-31075075 TTTGGTATACACAGGAGTCTTGG + Intergenic
1006775545 6:36589701-36589723 TTTGGTATCCTCAGGGGTCCTGG - Intergenic
1007393498 6:41563929-41563951 TATGGTATCCACAGGGATCCTGG + Intronic
1007741722 6:44014005-44014027 TTTGGTATCCGCAGGGGTCCTGG - Intergenic
1008353197 6:50517970-50517992 ATTGGTATCCACAGGGGCCCTGG - Intergenic
1008766712 6:54925796-54925818 TTTGGTATATGCAGAGGTCCTGG + Intronic
1008777167 6:55054115-55054137 TTTGGTATCCACAAGAGTCCTGG - Intergenic
1009314801 6:62204753-62204775 TTGAGTATACACTGGAGTTCTGG - Intronic
1010740339 6:79495388-79495410 TTTGGTATCCACAGGAGTCCTGG - Intronic
1011135194 6:84092660-84092682 TTTGGTGTATACAGGGGGCCTGG - Intergenic
1011427910 6:87250667-87250689 TTTGGTATCCACAGGAATCCTGG + Intronic
1011742852 6:90380416-90380438 TTTGGTATCCAGAGGGGTCCTGG - Intergenic
1011749068 6:90437061-90437083 TTTGGTATCCACAGGAGTTCTGG + Intergenic
1013063046 6:106656203-106656225 TTTGGTATCCACAGGGGTCTTGG + Intronic
1013076393 6:106775369-106775391 TTGGGTATAAAAAGGGGGCTGGG - Intergenic
1014802862 6:125796406-125796428 TTTGGTATCTGCAGGGGTCCTGG - Intronic
1015372730 6:132473318-132473340 TTTGGTATCCACAGGGGTCCTGG - Intronic
1015647670 6:135412347-135412369 TTTGGTATCCCCAGGGGTTCTGG + Intronic
1015787554 6:136933322-136933344 TTGGGTAAAAACAGGAGTGCAGG - Intergenic
1015794665 6:136998945-136998967 TTTGGTATCCTCAGGGGTCCTGG - Intergenic
1016167073 6:140959682-140959704 TTTGGCATCCACAGGGATCCTGG + Intergenic
1016442386 6:144096842-144096864 TTTGGTATCCATGGGGGTCCTGG + Intergenic
1016604565 6:145905476-145905498 TTTGGTATCCACAGGGGTTTTGG - Intronic
1017885944 6:158599607-158599629 TTGGGTCCACACAGTGGACCTGG + Intronic
1018129110 6:160711264-160711286 TTTGGTAGCCACAGGGGTCCTGG - Intronic
1019860766 7:3656618-3656640 TTGGCTTTCCACAGGGGTACAGG - Intronic
1020285986 7:6681057-6681079 TTTGGTATCCACAGGGGGTCTGG + Intergenic
1020632900 7:10661886-10661908 TTTGGTATCCAAGGGGGTCCTGG + Intergenic
1020663655 7:11012329-11012351 TTTGGTATCTGCAGGGGTCCTGG - Intronic
1021418966 7:20423192-20423214 TTTGGTTTCCTCAGGGGTCCTGG - Intergenic
1021752183 7:23813531-23813553 TTAGGTTTAAACAGAGGTCCTGG + Intronic
1021812469 7:24416303-24416325 TTTGGTAGCCACAGTGGTCCTGG - Intergenic
1023915241 7:44583497-44583519 TTTGGTATCCGTAGGGGTCCAGG + Intergenic
1024874076 7:54000865-54000887 TTTGGTATCCACAGGGGTCTTGG + Intergenic
1025173493 7:56782670-56782692 TTTGGTAGAAATAGGGGTCCTGG + Intergenic
1025698610 7:63795501-63795523 TTTGGTAGAAATAGGGGTCCTGG - Intergenic
1025830386 7:65044056-65044078 TTCAGTAAAAACAGGGGTCCTGG - Intergenic
1026073017 7:67139519-67139541 TTTGGTATCCACGGGGGTCCTGG - Intronic
1026445178 7:70478089-70478111 TTGGGTCTGCACAGCAGTCCAGG - Intronic
1026703867 7:72672697-72672719 TTTGGTATCCATGGGGGTCCTGG + Intronic
1026818786 7:73532670-73532692 TTTGGTATCCACCAGGGTCCTGG + Intergenic
1027797129 7:82709898-82709920 TTTGATATCCTCAGGGGTCCTGG + Intergenic
1027877031 7:83784063-83784085 TTTGGTATCCACAAGGGTACTGG - Intergenic
1028106427 7:86884570-86884592 TTTGGTATACTCAGGGGCCCTGG + Intronic
1028291504 7:89070955-89070977 TTTGGTATCCACAGGGGTCCTGG - Intronic
1028507084 7:91582613-91582635 TTGGGTATCTGCAGGGCTCCTGG + Intergenic
1029835912 7:103309643-103309665 TTTGGTATCCACAGGGATCTGGG + Intronic
1030087290 7:105827646-105827668 TTTGGTATACCCAGGGGTCCTGG + Intronic
1030887262 7:114953698-114953720 TAGGGTATGCTCAGGGGCCCTGG - Intronic
1031280952 7:119798331-119798353 TTTGGTATCCACAGGGGTTCTGG + Intergenic
1031529534 7:122859653-122859675 TTTGGTATTCATGGGGGTCCTGG - Intronic
1032305405 7:130729408-130729430 TTTGGTATACACAGGGATCCTGG - Intergenic
1032774066 7:135091323-135091345 TTTGGTATACATGGGGGTCCTGG - Intronic
1032804511 7:135341070-135341092 TGGTCTATACAGAGGGGTCCAGG + Intergenic
1032894843 7:136238768-136238790 TTTGGTATCCTCTGGGGTCCTGG + Intergenic
1032981755 7:137292164-137292186 TTTGGTTTCCACAGGGCTCCTGG - Intronic
1033481763 7:141749293-141749315 TTTGGTATCTATAGGGGTCCTGG + Intronic
1033524945 7:142202248-142202270 TTTGATATCCGCAGGGGTCCTGG - Intronic
1033569720 7:142615917-142615939 TTTGGTCAACACAGAGGTCCAGG - Intergenic
1034059531 7:148073949-148073971 TTTGGTATAGAAGGGGGTCCTGG + Intronic
1034595615 7:152188079-152188101 TTGGTTATACCTGGGGGTCCTGG + Intronic
1038752313 8:30306828-30306850 TTTGGTATCCATGGGGGTCCTGG - Intergenic
1038801261 8:30751066-30751088 TTTGGTATACTCAGGAGTCCTGG + Intronic
1039087885 8:33798053-33798075 TTTGGTATTCACGGGTGTCCTGG - Intergenic
1039708077 8:40027553-40027575 TTTGGTATCTGCAGGGGTCCTGG - Intergenic
1041095062 8:54341970-54341992 TTTGGTATCCTCTGGGGTCCTGG + Intergenic
1041103567 8:54420075-54420097 TTTGGTATCCATGGGGGTCCTGG + Intergenic
1041191677 8:55361549-55361571 TGGGCTATCCACAGGGGTCTGGG - Intronic
1042574236 8:70200188-70200210 TTTGGTATCCATGGGGGTCCTGG + Intronic
1043681776 8:83036522-83036544 TTTGGTATCCTCAGGGGTTCTGG + Intergenic
1043978874 8:86615150-86615172 TTTGGTTTCCTCAGGGGTCCTGG + Intronic
1044500608 8:92950918-92950940 TTTGGTTTCCACAGGAGTCCTGG - Intronic
1045999783 8:108405919-108405941 TTTGGTATATGCAGGGGTCCTGG - Intronic
1046808626 8:118507854-118507876 TTTAGTACACACAGGGCTCCTGG + Intronic
1046992366 8:120473003-120473025 TTTGTTATCCACAGGGGTCCTGG - Intronic
1047707541 8:127514779-127514801 TTGGGTTTACACAGTGGATCAGG + Intergenic
1049837019 8:144742799-144742821 TTGGGTATACGTGGGGGTCTCGG - Intronic
1050511557 9:6401469-6401491 TTTGGTATACATGGGAGTCCTGG - Intergenic
1050632934 9:7579814-7579836 TTGGAAATACACAGGGACCCAGG + Intergenic
1050962045 9:11746597-11746619 TTTGGTATACATGGAGGTCCTGG - Intergenic
1051120771 9:13749748-13749770 TTTGGTATGCACTGGGGGCCTGG + Intergenic
1051715322 9:19976736-19976758 TTTGGTATCTGCAGGGGTCCTGG + Intergenic
1052479516 9:29005633-29005655 TTTGGTATACATGGGTGTCCTGG - Intergenic
1052732416 9:32304877-32304899 TTTGATATACATGGGGGTCCTGG + Intergenic
1053638605 9:40043119-40043141 TTTGGTATCCTCTGGGGTCCTGG - Intergenic
1053767481 9:41422073-41422095 TTTGGTATCCTCTGGGGTCCTGG + Intergenic
1054319399 9:63639661-63639683 TTTGGTATCCTCTGGGGTCCTGG - Intergenic
1054546146 9:66333589-66333611 TTTGGTATCCTCTGGGGTCCTGG + Intergenic
1054727483 9:68666839-68666861 TTTGGTATCCACAGGGATCCTGG + Intergenic
1054843807 9:69771271-69771293 TTTGGTATCCACAGGGATCCTGG - Intergenic
1055979618 9:81989158-81989180 TTGGGCAGACATAGGGGTTCAGG + Intronic
1056297817 9:85210299-85210321 TTTGGTATCCACTGGGGTCCTGG - Intergenic
1056372880 9:85975419-85975441 TTTGGTATTCACAGGGGTCCTGG - Intronic
1056904069 9:90629601-90629623 TTTGGTATTCACAGGTGTCCTGG - Intronic
1058404195 9:104653298-104653320 TTGGGTATCCATGGGAGTCCTGG - Intergenic
1059647540 9:116282115-116282137 TTTGGTGTTCACAGAGGTCCTGG - Intronic
1060437002 9:123602115-123602137 GTTGGTATTCACAGGGGCCCTGG - Intronic
1061496325 9:130976754-130976776 TTTGGTATCCACAGGGGTCCTGG - Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1202786472 9_KI270719v1_random:26660-26682 TTTGGTATCCTCTGGGGTCCTGG - Intergenic
1185948906 X:4408458-4408480 TTTGGTATCCATAGGGGTCCTGG - Intergenic
1185964116 X:4580559-4580581 TTTGGTATAAGCAGGAGTCCTGG + Intergenic
1186181812 X:6980894-6980916 TTTGGTATCCACAGGGTTCCTGG + Intergenic
1186441215 X:9588271-9588293 TTTGGTATCTGCAGGGGTCCTGG + Intronic
1186446113 X:9630399-9630421 TTTGGTATATACAGGGGTCCTGG - Intronic
1186538215 X:10371775-10371797 TTGGGTATATATGGGGTTCCTGG + Intergenic
1186555239 X:10551001-10551023 TTTGGTATTCATAGGGGTCCTGG - Intronic
1186676286 X:11821026-11821048 TTGGGTATCCATGGGGGTTCTGG + Intergenic
1187591841 X:20725372-20725394 TTGGTTATCTGCAGGGGTCCTGG + Intergenic
1187993174 X:24897477-24897499 TTGGGTATGCACTGAGTTCCAGG - Intronic
1188074957 X:25763983-25764005 TTTGGTATACATGAGGGTCCTGG + Intergenic
1188197727 X:27259002-27259024 TTTGGTATCCACATGGGGCCTGG + Intergenic
1189221928 X:39379688-39379710 TTTGGTATCCACAGGGATCTTGG - Intergenic
1189454295 X:41170939-41170961 TTGGGTATATGCAGAGGTCCTGG - Intronic
1190117563 X:47636312-47636334 CTGGCCATACTCAGGGGTCCAGG - Exonic
1190250419 X:48719783-48719805 TTTAGTATCCACAGGGGTCCTGG + Intergenic
1190378763 X:49817466-49817488 TTTGGTATCTACAAGGGTCCTGG + Intergenic
1190384880 X:49875361-49875383 TTTGGTATCCACAGGGGTCCTGG + Intergenic
1190848836 X:54218261-54218283 TTTGGCATACGCAGGAGTCCTGG + Intronic
1192471318 X:71401395-71401417 TTTGGTATACTTGGGGGTCCTGG + Intronic
1192609504 X:72553644-72553666 TTTGGTATCTGCAGGGGTCCTGG - Intronic
1193596747 X:83455545-83455567 TTGGGTACACACGGGGTTCCTGG - Intergenic
1193993529 X:88338630-88338652 TTTGGTATTTGCAGGGGTCCTGG - Intergenic
1194118937 X:89937262-89937284 GTCAGTATACACAGGGGTCAGGG + Intergenic
1194452277 X:94059188-94059210 TTTGGTATCCACTGGGGTCCTGG - Intergenic
1194616493 X:96110259-96110281 TTTGCTATAGAGAGGGGTCCAGG + Intergenic
1196160887 X:112481068-112481090 TTTGTTATCCACAGGGGTCCTGG - Intergenic
1196173458 X:112615545-112615567 TTTGGTATCCAAAGGGGTCCTGG + Intergenic
1196260828 X:113578936-113578958 TTTGGTATTTGCAGGGGTCCTGG - Intergenic
1196402019 X:115326826-115326848 TTTGGTATCCACTGGGGTCCTGG - Intergenic
1196656468 X:118223195-118223217 TTGGGTATATGTAGGTGTCCTGG - Intergenic
1196804810 X:119574669-119574691 TGGGGCATACACTGGGGTCTCGG - Exonic
1196885049 X:120236513-120236535 TTTGGTATCTGCAGGGGTCCTGG - Intergenic
1198268042 X:135028922-135028944 TTTGGTATTTGCAGGGGTCCTGG + Intergenic
1199680440 X:150220787-150220809 CTTGGTATACACACGGATCCAGG + Intergenic
1200341718 X:155404025-155404047 TTGGGTATACATGGAGGTCCTGG - Intergenic
1200471813 Y:3594816-3594838 GTCAGTATACACAGGGGTCAGGG + Intergenic
1201736006 Y:17262404-17262426 TTCTGTATCCACAGGGTTCCTGG - Intergenic