ID: 1117352048

View in Genome Browser
Species Human (GRCh38)
Location 14:54890899-54890921
Sequence CTGTGTAGTCAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117352048_1117352051 -2 Left 1117352048 14:54890899-54890921 CCAGCTTCCCTCTGACTACACAG 0: 1
1: 0
2: 2
3: 27
4: 275
Right 1117352051 14:54890920-54890942 AGAACCCCTTTACTCCTTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 100
1117352048_1117352055 9 Left 1117352048 14:54890899-54890921 CCAGCTTCCCTCTGACTACACAG 0: 1
1: 0
2: 2
3: 27
4: 275
Right 1117352055 14:54890931-54890953 ACTCCTTGAAGGCCAAGATCAGG 0: 1
1: 0
2: 1
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117352048 Original CRISPR CTGTGTAGTCAGAGGGAAGC TGG (reversed) Intronic
900665354 1:3811364-3811386 CCCTGCAGTCAGAGGGCAGCGGG + Intergenic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
905688852 1:39927963-39927985 CTGTGCAGTTAGAGGGGAGAAGG - Intergenic
905888467 1:41504605-41504627 CTGAGCAGACAGAGGGCAGCCGG + Intergenic
905949602 1:41938106-41938128 CTGAGTAATGAGAGGGAACCAGG - Intronic
906144467 1:43551630-43551652 CTGGCAAGTCAGAGGGATGCAGG - Intronic
906746425 1:48225127-48225149 CTGCTGAGCCAGAGGGAAGCAGG + Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
909226404 1:73029879-73029901 CTGTATAGACAGAGTGATGCAGG + Intergenic
909662114 1:78095745-78095767 CTGGGTGGTAAGAGAGAAGCTGG - Intronic
909742295 1:79045433-79045455 CGGGGCAGTCAGAGGAAAGCTGG - Intergenic
912090821 1:106073114-106073136 CTCAGTAGTCAGAGTGAAACCGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
912933015 1:113981166-113981188 CTGGGTAGGCACAGGGCAGCTGG + Exonic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
917023520 1:170615433-170615455 CTGTGTAGTCTGGGAGAACCTGG - Intergenic
917511769 1:175674742-175674764 CTGAGAAGGCAGAGGGAACCTGG - Intronic
917851043 1:179064197-179064219 CTGTGGAGTCAGGGGCAAACCGG + Intronic
919894818 1:202002983-202003005 CTGTGTTGTCAGAGCCAAGTTGG - Intronic
920056534 1:203196919-203196941 CTGTGAAGGCAGAAGCAAGCCGG - Intergenic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
920708162 1:208270115-208270137 CTGTGTGGTCAGTGGAGAGCTGG + Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922165589 1:223113145-223113167 CTGTGGAGTCAGAGGAATGAAGG - Intronic
922220889 1:223557677-223557699 ATGTGTAGTCTGAGGGGTGCTGG - Intronic
923519819 1:234726678-234726700 CTGTTTTCTCAGGGGGAAGCGGG + Intergenic
1063457518 10:6194696-6194718 TTGTGGATTCAGTGGGAAGCTGG + Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065187966 10:23187707-23187729 CTTTGAAGTGTGAGGGAAGCAGG + Intergenic
1065204046 10:23341653-23341675 AGGTGAAGTCAGAGGGAAGGGGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067556458 10:47276721-47276743 TTGTGCAGTCAGAGGGTGGCAGG - Intergenic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068840593 10:61609474-61609496 TGGAGTAGCCAGAGGGAAGCGGG + Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1072237898 10:93468980-93469002 CTGTGTAGCCAGAAAGAGGCAGG - Intronic
1073098858 10:100996920-100996942 CTGTGAAGTCAGAGGCCAGAGGG + Intronic
1074766602 10:116704655-116704677 CTGTGTAGTAAAATGAAAGCAGG - Intronic
1074843511 10:117376563-117376585 CTAAGTAGTCAGAGGGCAGGAGG - Intergenic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1076822428 10:132946145-132946167 CTGTGGAGGCACAGGGGAGCAGG + Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1079248745 11:18772198-18772220 CTGTGTAGCAAGAGGCAAGCAGG - Intronic
1079467354 11:20743616-20743638 CTGTGGGGTAAGAGGAAAGCAGG - Intronic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083603368 11:63962271-63962293 CTGTGCTTTCAGAGGGCAGCTGG - Intergenic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1085038149 11:73311721-73311743 CGGTGCAGCCAGAGGCAAGCAGG - Exonic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086815594 11:91366707-91366729 CTATGTTGTCAGAGGTAAACAGG - Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1089235674 11:117022886-117022908 CTGTGTGGTAAGATGGAAGTGGG - Intronic
1089821839 11:121235693-121235715 TTGTGTAGTGAGAGTTAAGCAGG + Intergenic
1089962584 11:122629032-122629054 CTGTGCAGTAAGAGGGAGGCAGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1093159696 12:15731865-15731887 GTGTGTAGGCAAAAGGAAGCTGG + Intronic
1093232241 12:16560404-16560426 CTTTGTAATCAGAGGTAAGCAGG - Exonic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1096121905 12:49093968-49093990 CTGACTAGTGAGAGTGAAGCTGG - Intronic
1098179252 12:67828602-67828624 CTGGGTAGGCCTAGGGAAGCAGG - Intergenic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1099532494 12:83801453-83801475 GTGTCTAGTTAGAGGGAAGAAGG + Intergenic
1102856819 12:116301396-116301418 CTTTGTAGTCAGAGGGATCTGGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1104230139 12:126876736-126876758 CTCTGTAGCAAGAGGGAAGCAGG + Intergenic
1104282546 12:127391148-127391170 CTGGGAAGTCAGAGAGCAGCAGG - Intergenic
1105014011 12:132774993-132775015 CTGTGTAGTCAGTGGTAATGGGG - Intronic
1105063192 12:133172777-133172799 CTGGGATGTGAGAGGGAAGCAGG + Intronic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1107088797 13:36453676-36453698 CTGTGTGGTTAAAAGGAAGCAGG - Intergenic
1107684860 13:42886676-42886698 CTATGTAGGCAGAGGTAACCAGG - Exonic
1110957420 13:81572616-81572638 CTGTGTGGTCTGACTGAAGCAGG + Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1112899355 13:104340042-104340064 TTGTGTATACAGAGGCAAGCAGG - Intergenic
1113570754 13:111355242-111355264 CTGTGCAGTCTGAGAGATGCTGG + Intergenic
1113607975 13:111623795-111623817 TTGTGTAGTCCGATGGAGGCGGG + Intronic
1114691118 14:24582537-24582559 CAGAGTAGTTAGAGGGAAACAGG + Intergenic
1115079668 14:29435736-29435758 CTGTATACTCATAGGGAAGCTGG - Intergenic
1116689709 14:48089693-48089715 ATGTGTAGTCAGAAAGAAGTGGG - Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1118602444 14:67480397-67480419 CTCGGTAGCCACAGGGAAGCTGG - Intronic
1120227122 14:81803348-81803370 ATTTGTAGACAGATGGAAGCTGG - Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1125600642 15:40913781-40913803 CTGTGTAGATAGAGGAAGGCAGG + Intergenic
1126817310 15:52466537-52466559 CTGGGGTGTAAGAGGGAAGCAGG + Intronic
1126989264 15:54353725-54353747 CAGTGAGGTCAGAGGAAAGCTGG - Intronic
1127790313 15:62392518-62392540 CTCTGGAGTGAGGGGGAAGCGGG + Intronic
1128301402 15:66568275-66568297 CTGTGTCCTCAGGGGTAAGCAGG + Intergenic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133304144 16:4799520-4799542 CTGTGGGGTCAGGGGCAAGCTGG - Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133895997 16:9929499-9929521 CTGTGGATTCAGAGAGAAGTGGG - Intronic
1134077202 16:11300172-11300194 CTGTGGAGTCAGGTGGAACCTGG + Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1136090959 16:27919680-27919702 CTGTGTGGTCAGGGTGAGGCTGG - Intronic
1136318646 16:29468293-29468315 GTGTGAATTCAGAGGCAAGCGGG - Intergenic
1136433218 16:30207639-30207661 GTGTGAATTCAGAGGCAAGCGGG - Intronic
1136710627 16:32234025-32234047 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136810824 16:33174989-33175011 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136817300 16:33285069-33285091 CTGGGTAGGCAGAGGTGAGCAGG - Intronic
1136823863 16:33341598-33341620 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1137676780 16:50307593-50307615 GGGTGAAGTCAGAGGGAAGGGGG + Intronic
1139102247 16:63782689-63782711 CTGGGTAGTCAGAGAAAATCAGG + Intergenic
1203059434 16_KI270728v1_random:955737-955759 CTGGGTAGGCAGAGGTGAGCAGG + Intergenic
1142610009 17:1103884-1103906 TTGTGGAGTCTGAGGAAAGCTGG - Intronic
1144050236 17:11491741-11491763 TTGTGTACTGAAAGGGAAGCTGG + Intronic
1146571190 17:33954662-33954684 GGGTGAAGTCAGAGGGAATCAGG - Intronic
1147563768 17:41524360-41524382 CCGGGTAGGTAGAGGGAAGCAGG - Exonic
1148350308 17:46936719-46936741 CTGTGTGTTCAGAGCCAAGCAGG + Intronic
1149247279 17:54725266-54725288 ATGTGTTGTCAGATGGAAGGAGG + Intergenic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1150990702 17:70254923-70254945 CTATGAAGTCAGAGGTAGGCGGG + Intergenic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152386469 17:79977778-79977800 CTCTGTGGTCAGCGGGAAGCTGG - Intronic
1156895327 18:42239729-42239751 CTGGGTAGAGAGAGGCAAGCGGG - Intergenic
1158565289 18:58549856-58549878 CTGTGTCCTGAAAGGGAAGCAGG + Intronic
1158831789 18:61287593-61287615 GTGAGTACTCAGAGGGAAACAGG + Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1161282259 19:3452459-3452481 CTGCGGAGACAGTGGGAAGCGGG - Intronic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1163617079 19:18335710-18335732 CTGGGCAGTCAGAGGAGAGCTGG + Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1166732510 19:45067150-45067172 CTCTGTAGCCGGAGGGAGGCCGG + Intronic
1167706116 19:51082218-51082240 TTTTGTTGTCAGAGGGAAGGTGG - Intronic
925438670 2:3865144-3865166 CTGTGTAGGCCCAGGGAAGCAGG - Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
928248248 2:29650804-29650826 CTCTGAAGTCAGAGGGGAGGGGG - Intronic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932284265 2:70519143-70519165 GTGGGTATTCAGAGGGCAGCAGG + Intronic
934157775 2:89219177-89219199 CTGTGTAGTCACAGGGTCACAGG + Intergenic
934209489 2:89963249-89963271 CTGTGTAGTCACAGGGTCACAGG - Intergenic
935293772 2:101630752-101630774 ATGTGGAGTCAGAGTGAAGTAGG - Intergenic
937251200 2:120524894-120524916 CTGTGAGGTCAGAGGGAACCAGG - Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
939714165 2:145562143-145562165 CTTTATAGTCAGAAGGAATCAGG + Intergenic
940110599 2:150148376-150148398 TTATCCAGTCAGAGGGAAGCCGG + Intergenic
941477383 2:165966661-165966683 CTGTGTTGTGAGAGGGACCCAGG + Intergenic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
942604582 2:177676960-177676982 ATGTGTAGTAAGAGGGCATCTGG - Intronic
945527989 2:210912697-210912719 CTGTGTTGTCGGAGGGACCCAGG + Intergenic
946044353 2:216809450-216809472 CTGTGGAGTCAGAGTGAAATGGG + Intergenic
946247874 2:218397693-218397715 CTGTAGAGACAGAGGGCAGCTGG + Intergenic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947794361 2:232884887-232884909 CTGTGAAGTTTGGGGGAAGCTGG + Intronic
948914158 2:241022550-241022572 CTGAGTAGTGAGAGGTAGGCTGG - Intronic
1169127314 20:3138847-3138869 CTTTGTAGGCTGAAGGAAGCTGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1172979722 20:38931767-38931789 CTGTGTGGTCAGAGAGCTGCTGG - Intronic
1173044156 20:39493499-39493521 CTCTGTGGTCAGAGGTAGGCAGG - Intergenic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173879345 20:46399831-46399853 CTGTGTAGTTAGAGGGTATTGGG - Intronic
1174402766 20:50284825-50284847 CTGTGCAGGCAGCAGGAAGCTGG - Intergenic
1174582464 20:51581724-51581746 CTGTGGAGTCAGAGAGAGGGAGG - Intergenic
1179267280 21:39814899-39814921 CTGTGTACTCATATGGCAGCTGG - Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180660589 22:17463606-17463628 CTGGGGAGTTAGAGGGAATCAGG + Intronic
1181159183 22:20947131-20947153 CTGCTTAGACAGAGGGAACCTGG - Intronic
1181179068 22:21054651-21054673 CTGAGAAGTCAGAGAGAAGCGGG + Intronic
1181343675 22:22201698-22201720 CTGTGCAGTGAGAGAGGAGCAGG - Intergenic
1181364375 22:22363850-22363872 CTGTGTCCTCACAGGGAACCAGG + Intergenic
1181370852 22:22415646-22415668 CTGTGTCCTCACAGGAAAGCTGG + Intergenic
1182162662 22:28138719-28138741 CTGTGGAGTCAGAGGGGCACAGG - Intronic
1184039217 22:41933388-41933410 CTGTGTCCTCACAGGGAGGCTGG + Intergenic
1184564926 22:45286105-45286127 TGGAGTAGCCAGAGGGAAGCAGG - Intronic
1184575354 22:45359950-45359972 CTGTGTAATTACAGGGAAGTGGG - Exonic
1184666049 22:45989721-45989743 CTGTGTGGTGTGGGGGAAGCAGG - Intergenic
1185145278 22:49131073-49131095 TTTTGTAGACATAGGGAAGCTGG - Intergenic
1185174406 22:49313038-49313060 CTGTGTATTCAGGGTGAAGGTGG - Intergenic
949689218 3:6615381-6615403 GTGTCTACTCAGAGGCAAGCTGG - Intergenic
950194035 3:10996348-10996370 CTATGGAGTCAGTGGGAAGTGGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953758866 3:45671215-45671237 CTGAGCATTCAGAGGAAAGCTGG + Intronic
954186125 3:48918503-48918525 CTATCTGGTCAGAGGGGAGCTGG - Exonic
954590074 3:51775726-51775748 ATGTGTGGTCAGCGGGATGCTGG + Intergenic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
958161338 3:89819232-89819254 CTGTGGAGTCAGAGGGGGCCTGG - Intergenic
959148792 3:102582859-102582881 CTGTGTAGTCACAAGGAATCTGG - Intergenic
960155344 3:114292738-114292760 TTGGGTAGGCAGAGAGAAGCTGG + Intronic
960643873 3:119856236-119856258 CTGTGTAGTTAAAGGGAACTAGG + Intronic
960923678 3:122774737-122774759 CTGTGGAGACAGACAGAAGCAGG + Intronic
960947357 3:122975834-122975856 TTGTGTAGGCAGTGGGGAGCTGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
964447401 3:156774460-156774482 CTGTGTACTCAAAGAGAAGCTGG + Intergenic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968128719 3:196179403-196179425 CTGTGTAGTCAGATCTAAACTGG + Intergenic
968331320 3:197872958-197872980 CTGGGCAGTGAGAGGGAAGATGG + Intronic
970042947 4:11817262-11817284 CTCTGTCATCACAGGGAAGCTGG + Intergenic
973658731 4:53079587-53079609 ATGTGTAGGCAGAGGGAACTAGG + Intronic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
985492524 5:187911-187933 CTGTCAGGTCAGAGGGCAGCAGG + Exonic
986741724 5:10710781-10710803 CTGTGGAGTCAGTGAGAAGCAGG + Intronic
987101799 5:14597704-14597726 TTGTGAAGTCACATGGAAGCAGG - Intronic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
991441055 5:66649776-66649798 CTGTGGATTCAGAGTGAAACAGG - Intronic
992400580 5:76407798-76407820 TTGTGTAGTAAGAGGGTAGATGG - Intronic
992424329 5:76640561-76640583 CTTGGCAGTCCGAGGGAAGCGGG + Intronic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
995853668 5:116572806-116572828 ATGTGCAGTCTGAGGGAAGCCGG - Intronic
997612538 5:135225155-135225177 TTGTGGAGTCAGAGAGAAGTTGG + Intronic
997724101 5:136105887-136105909 CAGTGAAGACAGAGGTAAGCAGG - Intergenic
998397023 5:141825273-141825295 CAATGCAGTCAGAGGGAAGGGGG + Intergenic
1000702251 5:164467076-164467098 GTGGGTAGTCAGCGGGAAGGAGG - Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002499513 5:179638715-179638737 CTGGTCAGGCAGAGGGAAGCAGG - Intergenic
1003604411 6:7545989-7546011 TTGGATAGGCAGAGGGAAGCTGG + Intronic
1005463529 6:26090791-26090813 ATGTGTAGTAGGAGGGGAGCAGG - Intronic
1005805227 6:29468320-29468342 CTGTGGAGCCAGAGGAAAGGAGG - Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006751594 6:36381268-36381290 CTGTGGGGTCTGAGGGATGCCGG + Intronic
1007272597 6:40649818-40649840 CTGTGGAGTTAGAGGAAAGTAGG - Intergenic
1008649213 6:53546046-53546068 CTCTGTAGTGCGAGGGAAGAGGG - Intronic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012807685 6:103915784-103915806 CTGTATATTCAGAAGGGAGCTGG - Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1014729755 6:125019073-125019095 CTCTGTGATCAGAGGCAAGCGGG - Intronic
1015680873 6:135807217-135807239 CTGTGTAGTGAAAGGGCAGCAGG + Intergenic
1015883859 6:137896346-137896368 CTGTGTAGTCTGACAGCAGCTGG - Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016918806 6:149270944-149270966 CTGGGTAGTCAGAGGGTTACGGG + Intronic
1017939808 6:159041826-159041848 CTGTGAAGTCAGAGGAATGGCGG + Intronic
1019050942 6:169183161-169183183 CGGTGTAGGCAGAGGGAACTCGG - Intergenic
1019345144 7:526097-526119 CTGTGCAGTCAGAGAAAACCAGG + Intergenic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1023875055 7:44282357-44282379 CTGTGCAGTCACAGGGCAGAAGG + Intronic
1024461297 7:49662197-49662219 CTGTGCAGTCAGGGAGAAGGAGG - Intergenic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1028400657 7:90421959-90421981 CTGTGCAGTCACAGAGAACCGGG + Intronic
1031363827 7:120879849-120879871 CTGAGTTGTCAGTAGGAAGCTGG - Intergenic
1031894286 7:127330297-127330319 GTGTCTAGTCAAAGGTAAGCAGG + Intergenic
1032755268 7:134884368-134884390 GTGTGAAGTCAGAGCAAAGCGGG - Intronic
1032765923 7:134993511-134993533 CTGTGTAGTCCGGGGGAAGAAGG - Exonic
1033116143 7:138627166-138627188 GTCTGTAGGAAGAGGGAAGCGGG + Intronic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1036199683 8:6758327-6758349 CTGTGAAATCAAAGAGAAGCAGG - Exonic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038368982 8:26969171-26969193 TTGTGTAGTGAGAGGCAAGGAGG + Intergenic
1038680131 8:29659072-29659094 CTGGGCAGTCTGAGGGCAGCAGG + Intergenic
1039568954 8:38571629-38571651 CTGTGAAGTCAGAGCTGAGCGGG + Intergenic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1042153175 8:65811725-65811747 GTGTGTAGTTAGAGGGAAGAAGG + Intronic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1044489317 8:92793311-92793333 CTGAAGAGTCAGAGGGAAGTAGG + Intergenic
1046353506 8:113047093-113047115 CTGAGTGGTCTGAGGGAGGCTGG + Intronic
1047255258 8:123209110-123209132 CTGGGGAGCCAGAGGGGAGCAGG + Exonic
1049020957 8:139957428-139957450 CTCTGGAGTCAGAGAGAGGCAGG + Intronic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1050259675 9:3828280-3828302 CGGTGTAGACAGAGGAGAGCTGG + Exonic
1050785560 9:9396640-9396662 CAGTCTAGTCTGAGGGAAGGGGG + Intronic
1050916412 9:11140503-11140525 CTGAGTTGTCAGAGAGAAACTGG - Intergenic
1051024900 9:12596674-12596696 ATGTGTAGTCTGAAGGAAACAGG - Intergenic
1052181931 9:25539879-25539901 CTGTGTGGTCAGTGGAGAGCAGG + Intergenic
1052405218 9:28051086-28051108 CTGTGTAGGAAAAGGAAAGCAGG - Intronic
1052998451 9:34564330-34564352 CTATGTTGTCAGAGGGAATAGGG + Intronic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1057040231 9:91842691-91842713 CTCTGGAATCAGAGGGCAGCAGG + Intronic
1057076557 9:92141270-92141292 CGGTGCAGTCAGAGAGGAGCAGG - Intergenic
1057617246 9:96602665-96602687 ATGTGTAGTGGGAGGGACGCTGG - Intronic
1057867181 9:98690892-98690914 CTGTGCAGTCACAGGGCAGAAGG - Intronic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1058867248 9:109172105-109172127 CTGTGAACTCTGGGGGAAGCGGG + Exonic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1061238050 9:129353308-129353330 CTGGGGAGTCACAGGGAAGGTGG + Intergenic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1061949943 9:133930548-133930570 CTTGCTAGTCAGAGGGAAGAGGG + Intronic
1189174095 X:38936597-38936619 ATTTGTAGTCAGATGGCAGCTGG - Intergenic
1197724796 X:129769050-129769072 CTGTGGAGTAAGAGGGAATGCGG + Exonic
1197775770 X:130117867-130117889 ATGTGTCCTCAGAGTGAAGCTGG + Intergenic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic
1199428325 X:147729473-147729495 CTGTGAAGTCAGTGGGACTCTGG + Intergenic
1200821151 Y:7583799-7583821 CTGTGTAGTCATAGACTAGCTGG - Intergenic
1202189461 Y:22226033-22226055 CTATGTAGTCAGAGACTAGCTGG - Intergenic
1202239151 Y:22748943-22748965 CTGTGTAGTCATAGACTAGCTGG + Intergenic
1202392139 Y:24382710-24382732 CTGTGTAGTCATAGACTAGCTGG + Intergenic
1202478645 Y:25287407-25287429 CTGTGTAGTCATAGACTAGCTGG - Intergenic