ID: 1117360798

View in Genome Browser
Species Human (GRCh38)
Location 14:54971789-54971811
Sequence TCTGATATCCAGAGTCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9782
Summary {0: 1, 1: 77, 2: 1017, 3: 3349, 4: 5338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117360795_1117360798 24 Left 1117360795 14:54971742-54971764 CCCACAGAATGCAAGAAAATGTT 0: 2
1: 75
2: 1336
3: 14018
4: 18520
Right 1117360798 14:54971789-54971811 TCTGATATCCAGAGTCTATAAGG 0: 1
1: 77
2: 1017
3: 3349
4: 5338
1117360796_1117360798 23 Left 1117360796 14:54971743-54971765 CCACAGAATGCAAGAAAATGTTC 0: 1
1: 1
2: 44
3: 626
4: 3890
Right 1117360798 14:54971789-54971811 TCTGATATCCAGAGTCTATAAGG 0: 1
1: 77
2: 1017
3: 3349
4: 5338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117360798 Original CRISPR TCTGATATCCAGAGTCTATA AGG Intronic
Too many off-targets to display for this crispr