ID: 1117361278

View in Genome Browser
Species Human (GRCh38)
Location 14:54976680-54976702
Sequence GGAAGCAACACTTCTCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117361278_1117361280 -1 Left 1117361278 14:54976680-54976702 CCATACTGAGAAGTGTTGCTTCC 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1117361280 14:54976702-54976724 CAATCTTTGAAAAATATTTAAGG 0: 1
1: 0
2: 11
3: 102
4: 894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117361278 Original CRISPR GGAAGCAACACTTCTCAGTA TGG (reversed) Intronic
908543145 1:65140400-65140422 GGCAACAACACTGCTCTGTAAGG + Intergenic
911320919 1:96413192-96413214 GGAAGGGACACTTCTCAGTATGG - Intergenic
912186071 1:107277216-107277238 GGGAGCAACCCTTAGCAGTATGG + Intronic
915494947 1:156275590-156275612 GGAAGCAACCCATCTGAGTGAGG - Intronic
916204351 1:162300822-162300844 GGAAGCAACAGGTCTCAGGAGGG - Intronic
917286460 1:173426419-173426441 GAAAACAACACTCCTAAGTATGG - Intergenic
917797403 1:178542175-178542197 GGAAACAACCCTTCACTGTATGG + Intronic
921318946 1:213918723-213918745 GGAAGCATGACTTCCCAGCATGG - Intergenic
924132886 1:240930603-240930625 GGAAACCACAGTTCTCAGGATGG - Intronic
1063571602 10:7220319-7220341 GAAAGCAGCCCTTCTCAGAAGGG - Intronic
1066506513 10:36050264-36050286 GGATCCAACAATTCTCAGGAGGG - Intergenic
1067114969 10:43428361-43428383 GGATGCAAAATTTCTCAGAATGG - Intergenic
1069184792 10:65409571-65409593 GGCAGCAATACTGCTCTGTAAGG - Intergenic
1075669517 10:124254719-124254741 AGGAGCAACACATCTGAGTATGG - Intergenic
1075988044 10:126805108-126805130 GGAAGCAAAACATCTAAGAAAGG + Intergenic
1076309443 10:129493785-129493807 GGAAGCAGCCCTTTTCAGAAAGG + Intronic
1078344949 11:10540066-10540088 GAAAGCATCACTTCTCAGACGGG + Intronic
1081944017 11:46972610-46972632 GGAAGCACAACTTCTCTCTAAGG - Intronic
1085579320 11:77636783-77636805 GGAAGCAACACATATCTGAAGGG + Intronic
1086793387 11:91069338-91069360 GGAAGCAACTTTTCTCACCAAGG + Intergenic
1088499415 11:110468315-110468337 GAAAGCAACTATTCACAGTAAGG - Intergenic
1089517018 11:119039610-119039632 GGCAGCAATACTGCTCTGTAAGG - Intergenic
1091567554 12:1660254-1660276 GGAAGGCACAGTTCTCAGGAGGG + Intergenic
1091992616 12:4968355-4968377 GAAAGCAACTCTTCTAAGGATGG + Intergenic
1092142218 12:6191663-6191685 GGCAGCAATACTGCTCTGTAAGG - Intergenic
1094003666 12:25724190-25724212 TGAACTAACAATTCTCAGTATGG - Intergenic
1095561462 12:43571008-43571030 GGAAGCAACAATTTTCATTTTGG + Intergenic
1096527430 12:52219558-52219580 GGAAGACACACTTCTCACTAAGG - Intergenic
1096771131 12:53936720-53936742 GGGAGCAGCACTTCACAGAAGGG + Intergenic
1098258749 12:68646084-68646106 GGGAGCTACACTTCTTAGTGAGG - Intronic
1099096018 12:78375719-78375741 GGATGTAAAACTTCTTAGTAAGG + Intergenic
1100104229 12:91148878-91148900 GAAAGCAACACTTATATGTATGG + Intronic
1100986251 12:100204051-100204073 GGAAGCAATACTTACCTGTAAGG + Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109523010 13:63536668-63536690 GGAAGCAAAACCTCTCATCAAGG - Intergenic
1112406261 13:99123438-99123460 GGAGGCAACTTTCCTCAGTAAGG - Intergenic
1112584754 13:100708389-100708411 GGAAGCAGCACTTCTTACCAGGG - Intergenic
1114154491 14:20085192-20085214 GGCAGCAATACTGCTCTGTAAGG + Intergenic
1114330225 14:21629375-21629397 GGAAGCAACACATCTTACCATGG + Intergenic
1115003782 14:28455069-28455091 GGAAGCAACCCATCTCCCTATGG - Intergenic
1116626765 14:47274999-47275021 TGAAGCAACACCTCACAGAATGG - Intronic
1117361278 14:54976680-54976702 GGAAGCAACACTTCTCAGTATGG - Intronic
1117676249 14:58157643-58157665 GGAAGAAATGCTTCTCAGTATGG + Intronic
1119602125 14:75983128-75983150 GGAAGCCAGACCTCTCAGAAAGG - Intronic
1120210022 14:81624688-81624710 AGAAGAAACACCTCTCAGAATGG - Intergenic
1120989001 14:90358586-90358608 GGAAGCATGACTCTTCAGTATGG - Intergenic
1122130164 14:99600436-99600458 GGAAGTGACACTTCCCAGCATGG + Intronic
1122232197 14:100312131-100312153 GGCAGCAATACTGCTCTGTAAGG - Intergenic
1126633165 15:50757626-50757648 GGAAGTAGAACTTCACAGTATGG - Intronic
1130734822 15:86537069-86537091 GCAATCAACAGTTCTCAGTTAGG + Intronic
1132064696 15:98721188-98721210 GGAAGCAAGAGTCCTCAGTAAGG - Intronic
1135424521 16:22325728-22325750 GGAGGCAGCACTGCTCAGGAGGG - Intronic
1135860591 16:26052142-26052164 GGAAGGAACACTGCTCAGAGAGG + Intronic
1137229171 16:46546334-46546356 GCGAGCCACTCTTCTCAGTAAGG - Intergenic
1137243997 16:46688408-46688430 GGAAGCAGTACTTCTCCTTAGGG - Intronic
1137973484 16:53009560-53009582 GGAATCAAAACATCTCACTATGG - Intergenic
1143363181 17:6387874-6387896 TGAAGCAACACTTCCCGGGAAGG - Intergenic
1153437358 18:5081881-5081903 TCAAGAAACACTTCTCAGTGGGG + Intergenic
1156560121 18:38115526-38115548 GGAAGGAAAACATTTCAGTAGGG - Intergenic
1156636838 18:39041644-39041666 TGATGCTCCACTTCTCAGTATGG - Intergenic
1157126543 18:44961541-44961563 GGAAGTATCACTTCTCATCAAGG - Intronic
1159706968 18:71702678-71702700 GGCAGAAACACTACTCTGTATGG + Intergenic
1160622755 18:80182057-80182079 GGAAGCAACACAGCTGGGTAGGG + Intronic
1164424756 19:28131235-28131257 GGCAGCAATACTGCTCTGTAAGG + Intergenic
1165506410 19:36233709-36233731 GGCAGCAACACTGCTCTTTAAGG - Intronic
1167818921 19:51908532-51908554 GGCAGCAATACTGCTCTGTAAGG - Intronic
1167876877 19:52421298-52421320 GGCAGCAATACTGCTCTGTAAGG - Intergenic
1167910476 19:52698081-52698103 GGCAGCAATACTGCTCTGTAAGG - Intergenic
1168052404 19:53839230-53839252 GGCAGCAATACTGCTCCGTAAGG + Intergenic
1168219537 19:54950623-54950645 GGCAGCAATACTGCTCCGTAAGG - Intronic
928272546 2:29869488-29869510 GGAAGCATCACAAATCAGTAAGG + Intronic
930111181 2:47680157-47680179 GCAAGCAACCCTTCTCTGTGAGG + Intergenic
930443873 2:51446155-51446177 GGAAGAAAGACTTCTCACTCAGG - Intergenic
933426578 2:82120634-82120656 CTAAGGAACACTTCTCAGAAAGG - Intergenic
935131366 2:100263727-100263749 AGAAGGAATACTTCTCAGTGTGG + Intergenic
938953751 2:136280286-136280308 GGTGGCTACACTCCTCAGTAGGG - Intergenic
942937372 2:181574494-181574516 GAAAGCAACGCCTCTCAGCAGGG + Intronic
943011301 2:182453195-182453217 GGTAGCAAGACTCCTCATTAGGG + Intronic
943390027 2:187254558-187254580 GGAAGCAGCACTACCCAGAAGGG + Intergenic
943740301 2:191400073-191400095 GGATGAAACAGTTCTCAGAAAGG - Intronic
944258358 2:197648559-197648581 GGAAGCAACTCTTAACACTAAGG + Intronic
945505002 2:210629233-210629255 AGAAGCAACATTTCATAGTATGG + Intronic
945507265 2:210657082-210657104 TGAAGCAATGCTTCTCAGTTAGG + Intronic
948719471 2:239889542-239889564 GGCACCCACCCTTCTCAGTAAGG + Intergenic
1171377972 20:24708190-24708212 GGAAGCTAGACTTCTGAGTAGGG + Intergenic
1172197214 20:33100125-33100147 TGAGTGAACACTTCTCAGTAAGG - Intronic
1177252087 21:18605919-18605941 GGAAACAACCCTACTGAGTATGG + Intergenic
1178809232 21:35866325-35866347 GGCAGCAAGACTTCTTAGTTAGG - Intronic
1181011494 22:20043515-20043537 GGAAGCAGCACCACTCAGTTAGG - Intronic
1181634650 22:24169010-24169032 GGCAGCAACACTCCTGAGTAGGG + Intronic
952746626 3:36787813-36787835 GGCAGCACCAGTTCTGAGTAGGG - Intergenic
959159778 3:102708987-102709009 TAAAGCAACCCTACTCAGTATGG + Intergenic
961795713 3:129407489-129407511 GAAAGCTACATTTCCCAGTATGG + Intronic
962334631 3:134516274-134516296 GGCAGCAACACTGCTCTTTAAGG - Intronic
962464847 3:135648758-135648780 AGAAGCAACACAGCTCAGGAGGG + Intergenic
968221715 3:196944672-196944694 GGCAGCAATACTGCTCTGTAAGG + Intergenic
970810424 4:20086936-20086958 GAAAGCAAGACTTCTGAGGAGGG - Intergenic
972259637 4:37395402-37395424 GGAAGCAATACATCTCAGACAGG + Intronic
972259707 4:37395943-37395965 GGAAGCAATACATCTCAGACAGG - Intronic
974434125 4:61834909-61834931 GGGAGTGTCACTTCTCAGTAGGG + Intronic
978616420 4:110601170-110601192 GGAAGAACCACTTTTAAGTAAGG - Intergenic
982450067 4:155542740-155542762 GCAAGCAACACTGCTCACTCAGG - Intergenic
982661688 4:158214790-158214812 GGAAGCAAGAGTACTCAGTGTGG + Intronic
983215939 4:165002554-165002576 GGCAGCAATACTGCTCTGTAAGG + Intergenic
985765199 5:1774493-1774515 GGCATGAGCACTTCTCAGTATGG + Intergenic
986008998 5:3695213-3695235 GCAAGCAACAGTGCTCAGTGGGG + Intergenic
986947795 5:13046110-13046132 GGAAGCGAGAATTCTCAGAAAGG + Intergenic
989517500 5:42360497-42360519 TAAAGCAAAACTTCCCAGTATGG + Intergenic
993537649 5:89106345-89106367 GAAACCAACACTTCTCAATATGG - Intergenic
995378323 5:111503186-111503208 GGCAGCATCACTTATCAGTGGGG + Intronic
1000364771 5:160480604-160480626 GGAAGCAACACTTCTTGTTTAGG + Intergenic
1002503802 5:179665138-179665160 GGAAGCACCCCTTCTCTGCATGG - Intergenic
1003292328 6:4789832-4789854 GGAAACTACACTTCTCTGAATGG - Intronic
1004833482 6:19503339-19503361 GGCACCAAGACTACTCAGTAGGG - Intergenic
1005400263 6:25424859-25424881 GGAAGCCATACTTGTGAGTATGG + Intronic
1008005168 6:46402628-46402650 GGAAGGAACACTGCTCAGACAGG + Intronic
1009538115 6:64916953-64916975 GGAAGAAATACTACTCATTAAGG + Intronic
1011389846 6:86839516-86839538 GGAAGCGACTCTTCTCTGCATGG - Intergenic
1011821451 6:91257682-91257704 GGAAGGAACACTACACAGAAAGG - Intergenic
1013551632 6:111213258-111213280 GGAATCAACACTTAACAGTTCGG - Intronic
1014135960 6:117890319-117890341 TGAAACAACACTACACAGTAGGG + Intergenic
1014786761 6:125628212-125628234 AGATGCAACACCACTCAGTATGG - Intergenic
1015821972 6:137271150-137271172 GGAAGCAAGACTTTTCTGAATGG - Intergenic
1017022793 6:150153976-150153998 GGAACGAACACTTCACATTATGG + Intronic
1022891751 7:34708264-34708286 GGAAGGAACCCTTCCCAGCAGGG + Intronic
1024012251 7:45278948-45278970 CGAGGCAACACTTCACAGTGAGG - Intergenic
1026008620 7:66619302-66619324 GGAAGCAATACTGCTCTTTAAGG - Intergenic
1031961129 7:127991014-127991036 GGAAGCTACACTTTTCACCAAGG + Exonic
1033212163 7:139468010-139468032 GGCAGCAACACTGCTCTTTAAGG + Intronic
1034490594 7:151391242-151391264 GGAAGCAGGACTTCTGGGTATGG - Intronic
1036755679 8:11469483-11469505 GGAAAGAAAACTTCTCTGTAAGG - Intronic
1037564350 8:20104979-20105001 GGAAGCAACATGTATCAGTCAGG - Intergenic
1038417575 8:27408344-27408366 GGAAGGAACACTGCTCAGAGAGG + Intronic
1039881940 8:41630577-41630599 GGGGGCAGCCCTTCTCAGTAGGG - Intergenic
1040961120 8:53034344-53034366 CGAAGAAACACTTCTATGTAGGG + Intergenic
1042858617 8:73292859-73292881 GTAAACAACACTGCTCAGTACGG - Intronic
1043019446 8:74983390-74983412 GGAAGCATCACTTATTAGAAAGG - Intergenic
1048219141 8:132525540-132525562 GGAAGAAATATTCCTCAGTAAGG + Intergenic
1048592209 8:135831281-135831303 GGATGCATCAATTTTCAGTAAGG - Intergenic
1055007127 9:71520836-71520858 GGAAGCACCAGTTCTCTGTGAGG + Intergenic
1060702549 9:125770505-125770527 GGAAGGAATACTATTCAGTAAGG + Intronic
1061501460 9:131005380-131005402 GGTAAAAACACTTCTAAGTAAGG - Intergenic
1061704647 9:132443628-132443650 TGAAGCAACAATGCTCAGTTTGG + Intronic
1186039541 X:5460865-5460887 GGAAGAAACACTGCTCAGAAAGG + Intergenic
1187929086 X:24277471-24277493 GGATGCAGCTCTTCTCAGTGCGG - Intergenic
1195930372 X:110068478-110068500 GAAAGTAACAATTCTCATTATGG + Intronic
1196905804 X:120432998-120433020 GGCAAGAACATTTCTCAGTAAGG + Intronic