ID: 1117369398

View in Genome Browser
Species Human (GRCh38)
Location 14:55062887-55062909
Sequence CTGGATAAGGACCACCAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117369398_1117369405 -1 Left 1117369398 14:55062887-55062909 CCCACCTGGTGGTCCTTATCCAG 0: 2
1: 0
2: 1
3: 15
4: 228
Right 1117369405 14:55062909-55062931 GCCCCAACTGTGCCGGGCCCTGG 0: 1
1: 0
2: 2
3: 18
4: 225
1117369398_1117369402 -8 Left 1117369398 14:55062887-55062909 CCCACCTGGTGGTCCTTATCCAG 0: 2
1: 0
2: 1
3: 15
4: 228
Right 1117369402 14:55062902-55062924 TTATCCAGCCCCAACTGTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1117369398_1117369403 -7 Left 1117369398 14:55062887-55062909 CCCACCTGGTGGTCCTTATCCAG 0: 2
1: 0
2: 1
3: 15
4: 228
Right 1117369403 14:55062903-55062925 TATCCAGCCCCAACTGTGCCGGG 0: 1
1: 1
2: 2
3: 20
4: 152
1117369398_1117369410 9 Left 1117369398 14:55062887-55062909 CCCACCTGGTGGTCCTTATCCAG 0: 2
1: 0
2: 1
3: 15
4: 228
Right 1117369410 14:55062919-55062941 TGCCGGGCCCTGGCCCCACAGGG 0: 1
1: 0
2: 3
3: 26
4: 229
1117369398_1117369409 8 Left 1117369398 14:55062887-55062909 CCCACCTGGTGGTCCTTATCCAG 0: 2
1: 0
2: 1
3: 15
4: 228
Right 1117369409 14:55062918-55062940 GTGCCGGGCCCTGGCCCCACAGG 0: 1
1: 1
2: 3
3: 35
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117369398 Original CRISPR CTGGATAAGGACCACCAGGT GGG (reversed) Exonic
900225244 1:1529915-1529937 CTGGAAAAGCAAAACCAGGTTGG + Intronic
900600933 1:3502391-3502413 CTGGATCAGCATCGCCAGGTTGG - Intronic
900699356 1:4034444-4034466 GTAGAGAAAGACCACCAGGTGGG - Intergenic
902515275 1:16986577-16986599 CAGGACAAGGCCCACCAGGACGG + Exonic
903557330 1:24203227-24203249 CTGGAAAGGGCCCAGCAGGTGGG + Intergenic
903668908 1:25024121-25024143 CTGAATAAGTACCACCAAGGTGG + Intergenic
905149626 1:35917638-35917660 CTGGAAAAGGACTACCAGCCTGG + Exonic
905512205 1:38530412-38530434 CTGACTAAGTACCACCAGGCAGG - Intergenic
907387593 1:54136144-54136166 ATGGATTTGGATCACCAGGTTGG + Intronic
911806160 1:102211072-102211094 GTAGATAAAGACCACCAGGTGGG + Intergenic
912683460 1:111743606-111743628 GTGGATAGGGACCTCCAGGTGGG - Intronic
914992187 1:152508381-152508403 CTAGATAAAGACCACAGGGTTGG - Intergenic
918819725 1:189237020-189237042 GTAGAGAAAGACCACCAGGTTGG + Intergenic
922118214 1:222635060-222635082 CAGGAGAAAGACCACCAGGATGG + Intronic
922657923 1:227402041-227402063 GTAGAGAAGGACCATCAGGTGGG - Intergenic
923446995 1:234081096-234081118 CTGAAGAAGGAAGACCAGGTGGG - Intronic
924880166 1:248152404-248152426 GTAGATAAATACCACCAGGTGGG + Intergenic
1063561284 10:7130471-7130493 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1068243273 10:54333778-54333800 CTGCATCAGGATCACCTGGTAGG - Intronic
1071554722 10:86593244-86593266 CTGGATAGAGACCTCCAGCTAGG + Intergenic
1072381742 10:94879525-94879547 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1072626430 10:97115315-97115337 CAGGATAAGTACCAGCAGGAAGG - Intronic
1074127361 10:110539647-110539669 CTGGATTAGGACCAACTGGGGGG + Intergenic
1076258956 10:129050657-129050679 CTGGAGCAGTTCCACCAGGTAGG + Intergenic
1076666292 10:132094834-132094856 ATGGGGAAGGACCATCAGGTGGG + Intergenic
1077834259 11:5910552-5910574 GTAGAGAAAGACCACCAGGTGGG + Intronic
1079215091 11:18502534-18502556 CAGGATATGGACCACCAGGTGGG + Exonic
1081091112 11:38867372-38867394 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1084107254 11:66988210-66988232 CTGAACATGGGCCACCAGGTAGG - Intergenic
1085240619 11:75051004-75051026 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1087430258 11:98044865-98044887 CTGGGAAATGATCACCAGGTGGG + Intergenic
1087619493 11:100525712-100525734 GTAGGGAAGGACCACCAGGTGGG - Intergenic
1087817548 11:102676154-102676176 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1088832137 11:113546585-113546607 CTGGATAAGGATCATCTGGGAGG - Intergenic
1089836970 11:121379214-121379236 ATAGAAAAAGACCACCAGGTGGG - Intergenic
1091646088 12:2273517-2273539 CTGGGTTAGGACCAGCAGGACGG + Intronic
1093690519 12:22103301-22103323 CTGGATAAGACCCACCGGCTTGG - Intronic
1096538152 12:52288394-52288416 CTGGATCAGGGCCTCCACGTTGG + Exonic
1096542818 12:52317714-52317736 CTGGATCAGGGCCTCCACGTTGG + Exonic
1096956864 12:55534889-55534911 ATAGAGAAGGACCATCAGGTGGG - Intergenic
1097626058 12:62002005-62002027 ATGGTTAAGGTCCTCCAGGTTGG - Intronic
1100795298 12:98175863-98175885 GGGGATAGGGACCACCATGTGGG - Intergenic
1107702036 13:43058406-43058428 GTAGAGAAGGATCACCAGGTTGG + Intronic
1108188969 13:47917547-47917569 CTAGAGAAAGACCATCAGGTGGG - Intergenic
1108298707 13:49052820-49052842 GTGGAAAAAGACCACCAGGTGGG + Intronic
1109250386 13:60012636-60012658 TTAGCTAAGGACAACCAGGTAGG - Intronic
1110181815 13:72626184-72626206 CTAGAGAAAGACCACCAGGTGGG - Intergenic
1115789760 14:36865699-36865721 CTGCATAAGAATCACCAGGGAGG + Intronic
1116063919 14:39958464-39958486 GTAGAGAAAGACCACCAGGTTGG - Intergenic
1117369398 14:55062887-55062909 CTGGATAAGGACCACCAGGTGGG - Exonic
1119679689 14:76583551-76583573 TTGGAGCAGGACCACCTGGTTGG - Intergenic
1120400319 14:84022920-84022942 GTCGAGAAAGACCACCAGGTGGG + Intergenic
1125247117 15:37653194-37653216 GTAGAGAAAGACCACCAGGTGGG - Intergenic
1125269391 15:37921565-37921587 GTAGAAAAGGACCATCAGGTGGG + Intergenic
1125355456 15:38812925-38812947 CTAGATAAGCTCCATCAGGTTGG + Intergenic
1126184808 15:45821637-45821659 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1126807622 15:52367944-52367966 CTGGATAAGGATTCCCAGGAAGG + Intronic
1131640419 15:94286632-94286654 CTGAATAAGAACCGCAAGGTAGG - Intronic
1132126205 15:99227457-99227479 CTGGAAAAGGAGCATCAGTTAGG - Intronic
1133956006 16:10444380-10444402 CTAGATAAGGTCTCCCAGGTTGG + Intronic
1134125927 16:11616010-11616032 CTTGATAAGAACCACTAGATAGG + Intronic
1137908580 16:52351938-52351960 CTGGCTAAGAACCACGATGTAGG + Intergenic
1138278708 16:55756101-55756123 CACCATCAGGACCACCAGGTAGG - Intergenic
1138721786 16:59090769-59090791 CTGGATAAGGGCCACCCACTTGG - Intergenic
1139584611 16:67893696-67893718 AAGGACAAGGACAACCAGGTTGG - Intronic
1140944229 16:79752854-79752876 CTGCTTAAGGACCCCCAGGGAGG + Intergenic
1143327837 17:6111112-6111134 GTGGATGGGGACCACCAGGCGGG - Intronic
1143609920 17:8012328-8012350 CTTGATAAGGTCCAGCAGGAGGG - Exonic
1144717980 17:17447377-17447399 CTGGATCAGGATCACCAGGGTGG + Intergenic
1148814928 17:50320836-50320858 CAGGAAAATGACTACCAGGTGGG - Intergenic
1154339836 18:13493834-13493856 CTGGACAAGGACCACGGGGCTGG - Intronic
1155649148 18:28119306-28119328 CTGGCAAAGGACCACCATATGGG + Intronic
1156317948 18:35988454-35988476 GTGGTTAAGGAGCACCAGCTTGG + Intronic
1156607104 18:38679719-38679741 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1160488957 18:79320657-79320679 CTGCATATGGACCATCTGGTTGG + Intronic
1161846183 19:6713146-6713168 CAGGCTCAGGACCACCAAGTGGG - Intronic
1163725854 19:18922666-18922688 CTGGATCAGGTGGACCAGGTAGG - Exonic
1164267468 19:23633020-23633042 ATAGAAAAGGACCATCAGGTGGG - Intronic
1166783292 19:45353237-45353259 CTGGAGAAGTACCAGGAGGTGGG - Exonic
1167797201 19:51717114-51717136 CTGGACGAGGACCCCCGGGTAGG - Exonic
925795656 2:7539616-7539638 GTAGAGAAAGACCACCAGGTGGG + Intergenic
926108935 2:10169954-10169976 CTGGATCAGAACCATCAGGTGGG - Intronic
927071612 2:19536460-19536482 GTGGAGAAAGACCACCAGGTCGG - Intergenic
927176799 2:20415609-20415631 GTGGAGAAAGACCACGAGGTGGG + Intergenic
927254887 2:21032449-21032471 GGGGATCAGGGCCACCAGGTAGG + Exonic
929215856 2:39412220-39412242 CTGGAAAAAGACCACCAAATTGG + Intronic
929945526 2:46368895-46368917 CTGCCTAAGAACCACCAGGTTGG - Intronic
931392135 2:61853716-61853738 CTGGGCCAGGACCACCAAGTAGG + Intronic
932098622 2:68875406-68875428 CTGGCTAATAACCACCATGTTGG + Intergenic
936689530 2:114869970-114869992 CTGTAAAATGATCACCAGGTAGG + Intronic
938938313 2:136146946-136146968 CAGGGAAATGACCACCAGGTGGG - Intergenic
938996397 2:136683314-136683336 GTAGAGAAAGACCACCAGGTTGG - Intergenic
939801881 2:146720773-146720795 CTGGAAAAGCACCATCTGGTTGG - Intergenic
943449340 2:188028598-188028620 GTGGGTAAGGACCATCAGGTGGG + Intergenic
944073102 2:195695201-195695223 GTAGAGAAAGACCACCAGGTTGG + Intronic
948531213 2:238606792-238606814 ATAGAGAAGGACCATCAGGTGGG - Intergenic
948944451 2:241212385-241212407 CTGGGTAGGGACCAAGAGGTGGG - Intronic
1169398934 20:5262985-5263007 CTGGAAAAGGATCACAGGGTAGG + Intergenic
1170086269 20:12535643-12535665 GTGTAGAAAGACCACCAGGTTGG - Intergenic
1170727595 20:18943576-18943598 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1175138292 20:56841386-56841408 CTGGGTAAGGACCACCCTGAGGG - Intergenic
1177127749 21:17217155-17217177 GTAGAGAAAGACCACCAGGTGGG - Intergenic
1181990941 22:26836225-26836247 CTAGAGAAGGAACACCAGGGTGG - Intergenic
1184583313 22:45431166-45431188 CCAGATGAGGACCACCAGGGCGG - Intronic
952082888 3:29782028-29782050 GTAGAGAAAGACCACCAGGTGGG - Intronic
952530908 3:34260778-34260800 AGGGAGAAGGGCCACCAGGTGGG + Intergenic
952732488 3:36653406-36653428 CTAGAGAAAGACCACCAGGTGGG - Intergenic
952900990 3:38111744-38111766 CTGGGTAAGCGCCACCAGGGTGG + Exonic
953780170 3:45861968-45861990 AAAGATAATGACCACCAGGTGGG - Intronic
954155107 3:48681073-48681095 CTGGACAAGGGCCACAAGGCAGG - Intronic
954501857 3:51025173-51025195 GTGGAGAAATACCACCAGGTTGG + Intronic
955175614 3:56611170-56611192 ATAGAGAAGGACCACCAGGTGGG + Intronic
956680165 3:71771578-71771600 ATGGATAAAGACCCCAAGGTTGG - Intergenic
959125894 3:102290322-102290344 ATAGAGAAAGACCACCAGGTGGG + Intronic
959802512 3:110512284-110512306 GTAGAGAAGGACCATCAGGTGGG + Intergenic
960064374 3:113354677-113354699 GTAGAGAAAGACCACCAGGTGGG - Intronic
964075680 3:152688769-152688791 CTAGAGAAAGACCATCAGGTAGG - Intergenic
964299367 3:155271114-155271136 GTAGAGAAAGACCACCAGGTTGG - Intergenic
964867356 3:161276171-161276193 GTGGAGAAAGACCATCAGGTGGG - Intergenic
965101599 3:164306038-164306060 GTAGAGAAAGACCACCAGGTGGG - Intergenic
965296639 3:166955595-166955617 GTAGAGAAAGACCACCAGGTGGG + Intergenic
966229906 3:177640675-177640697 GTAGAGAAAGACCACCAGGTGGG + Intergenic
966593398 3:181704859-181704881 CTGGATTAGGACCCCCAGTCTGG - Intergenic
968665128 4:1816760-1816782 CTGGAGATGGACCAGCAGGCTGG - Exonic
969301772 4:6301231-6301253 CTGGCCAAGGACCTTCAGGTAGG - Exonic
969645931 4:8428743-8428765 CTGGATCAGGACCCCCAGTCTGG + Intronic
970152129 4:13101126-13101148 ATGGATAGGGAACACCAGGAGGG - Intergenic
970282972 4:14478562-14478584 GTAGAGAAAGACCACCAGGTAGG - Intergenic
971050395 4:22855441-22855463 GTAGAGAAAGACCACCAGGTCGG + Intergenic
971986632 4:33833594-33833616 ATGAATCAGGACCTCCAGGTGGG + Intergenic
973676035 4:53263896-53263918 GTAGAGAAAGACCACCAGGTGGG + Intronic
973942417 4:55924193-55924215 CAGGTGAAGGACTACCAGGTAGG + Intergenic
974506034 4:62773255-62773277 CTAGATTAGGAACACCAGTTAGG + Intergenic
974950978 4:68582655-68582677 GTAGGGAAGGACCACCAGGTGGG - Intronic
975414200 4:74088843-74088865 CTGGATAAGGACACCCAGCGTGG - Intergenic
975509811 4:75181421-75181443 GTAGATAAAGACCATCAGGTGGG - Intergenic
976791293 4:88881015-88881037 GTGGAGAAAGACCATCAGGTGGG - Intronic
976918164 4:90404358-90404380 GTAGAGAAAGACCACCAGGTGGG - Intronic
978324760 4:107539912-107539934 CTGTATATGGCACACCAGGTTGG + Intergenic
979030145 4:115633395-115633417 GTAGAGAAAGACCACCAGGTAGG + Intergenic
980761414 4:137238846-137238868 GTAGAGAAAGACCACCAGGTAGG + Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
980861043 4:138499983-138500005 GTAGAGAAAGACCACCAGGTTGG + Intergenic
981400965 4:144313504-144313526 GTAGTTAAGGACCATCAGGTGGG + Intergenic
982680135 4:158418991-158419013 GTAGAGAAGGACCATCAGGTGGG + Intronic
983776131 4:171609684-171609706 GTGGAGAAATACCACCAGGTAGG - Intergenic
985525426 5:399042-399064 GGGGATAAGAACCACCCGGTAGG - Intronic
985561887 5:592171-592193 GTAGAGAAAGACCACCAGGTGGG + Intergenic
986259025 5:6126302-6126324 GTAGAGAAAGACCACCAGGTAGG - Intergenic
986634008 5:9801922-9801944 GTAGAGAAAGACCACCAGGTTGG - Intergenic
987527636 5:19073871-19073893 CTAGAGAAAGACCACCAGGTGGG - Intergenic
988725179 5:33919783-33919805 GTAGAGAAGGACCATCAGGTGGG + Intergenic
989084219 5:37657700-37657722 CTGAATCAGGACCATCTGGTAGG + Intronic
989355451 5:40539267-40539289 GTAGAAAAAGACCACCAGGTTGG + Intergenic
992774587 5:80078205-80078227 CTGGTTCAGGACCACCCAGTTGG - Exonic
993920492 5:93795053-93795075 GTAGAGAAGGACCACAAGGTGGG + Intronic
995518307 5:112976083-112976105 ATGAATAAGGACGAGCAGGTGGG + Intergenic
998174223 5:139891645-139891667 CTGGATAAAGACCCTAAGGTGGG + Intronic
999172305 5:149605969-149605991 CTGGAGAAGGACAAGCAGGGAGG + Intronic
999380416 5:151117529-151117551 CAGGACAAGGGCCACCAGGGAGG + Intronic
999959469 5:156738666-156738688 GTGGATAAGGAACACCAGAGAGG + Intronic
1001405570 5:171474716-171474738 CTGGAGAAGGACGCCCAGTTTGG - Intergenic
1003347068 6:5279829-5279851 TTGGATGAGGACCACCACATTGG + Intronic
1005982340 6:30845938-30845960 CTGGTTCATGATCACCAGGTTGG - Intergenic
1006295432 6:33168077-33168099 CAGGAGACGGGCCACCAGGTAGG - Intronic
1006518661 6:34558842-34558864 CTGGAAAAGGTCCACCAAGAGGG + Intergenic
1007039055 6:38704507-38704529 CTGGATTAGGACCACCTGATTGG + Intergenic
1007281001 6:40712416-40712438 CTGGACCAGCATCACCAGGTGGG + Intergenic
1007768819 6:44177332-44177354 CTGCATTAGGGCCACCAGGCAGG - Exonic
1008402302 6:51078124-51078146 CTAGAGAAAGACCACCTGGTGGG + Intergenic
1011923942 6:92618223-92618245 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1012582843 6:100889890-100889912 CTGGATAAGGACCACCAGGTGGG - Intergenic
1019123455 6:169823941-169823963 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1019435722 7:1021172-1021194 CAGGTTAAGAACCTCCAGGTTGG + Intronic
1021046811 7:15933132-15933154 ATTGAAAAGGACCACCAGTTTGG + Intergenic
1022392819 7:29958243-29958265 CTGGCTAATCACAACCAGGTGGG + Intronic
1023657590 7:42440864-42440886 GTAGAGAAAGACCACCAGGTTGG + Intergenic
1023748963 7:43351466-43351488 GTAGGGAAGGACCACCAGGTGGG + Intronic
1027563553 7:79762392-79762414 GTAGAGAAAGACCACCAGGTCGG + Intergenic
1028197763 7:87926955-87926977 GTAGAGAAAGACCACCAGGTAGG - Intergenic
1029919055 7:104242938-104242960 ATGGATGAGGACCGCCAAGTAGG + Intergenic
1030533480 7:110737561-110737583 GTAGAGAAAGACCACCAGGTGGG - Intronic
1032068872 7:128791753-128791775 CTGGGGAGGGACCACCAGGCAGG - Intronic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1032286347 7:130540833-130540855 CTGGACATGGACCCCCAGGCAGG + Intronic
1035870733 8:3133723-3133745 CTGGCTCAGGACCTACAGGTTGG + Intronic
1038688103 8:29737177-29737199 CTGTATAATGACAACCAGGTGGG - Intergenic
1038755823 8:30339979-30340001 CCATATAAGGACAACCAGGTGGG + Intergenic
1041293733 8:56333397-56333419 ATAGAGAAGGACCATCAGGTGGG + Intergenic
1042143357 8:65702211-65702233 CTGGATAAAGACAACCAGAATGG - Intronic
1042645516 8:70982287-70982309 GTAGAGAAAGACCACCAGGTCGG + Intergenic
1042768409 8:72352610-72352632 GTAGAGAAGGACCATCAGGTGGG + Intergenic
1043556746 8:81439196-81439218 GTAGAGAAAGACCACCAGGTAGG + Intergenic
1044907258 8:97017777-97017799 GTAGGGAAGGACCACCAGGTGGG - Intronic
1046904104 8:119553852-119553874 CTGGAACAGGACCACCATGCTGG + Intergenic
1047130743 8:122017369-122017391 ATAGGTAAGGACCATCAGGTGGG + Intergenic
1049831841 8:144705688-144705710 CTGGATAAGCATCACATGGTGGG + Intergenic
1050147399 9:2583711-2583733 GTAGGTAAGGACCATCAGGTCGG - Intergenic
1050903478 9:10974825-10974847 ATAGAGAAAGACCACCAGGTTGG - Intergenic
1051929431 9:22367128-22367150 ATAGAGAAAGACCACCAGGTGGG - Intergenic
1053161043 9:35813639-35813661 CTCTATGAGGACCAGCAGGTGGG - Exonic
1055156336 9:73067096-73067118 CTAGAGAAAGACTACCAGGTAGG - Intronic
1056396619 9:86187046-86187068 GTAGAGAAAGACCACCAGGTGGG - Intergenic
1060044256 9:120327437-120327459 ATGGATCAGGAGCACCAGGGAGG + Intergenic
1060311168 9:122464041-122464063 CTAGAGAAAGACCATCAGGTAGG + Intergenic
1060314445 9:122496329-122496351 GTTGAGAAAGACCACCAGGTGGG + Intergenic
1060788424 9:126468665-126468687 CTGGAGCAGGAACACCAGGGAGG - Intronic
1062713591 9:137990344-137990366 GTAGAGAAAGACCACCAGGTGGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185821471 X:3208989-3209011 CTGGCTAAGGGGGACCAGGTGGG - Intergenic
1186308395 X:8289995-8290017 GTAGAGAAAGACCACCAGGTTGG - Intergenic
1187047308 X:15659995-15660017 CTGTTTAAGGACCACCAAGGAGG + Intronic
1187588864 X:20693569-20693591 GTAGAGAAGGACCACCAGGTGGG - Intergenic
1188045886 X:25426045-25426067 GTAGAGAAGGACCATCAGGTGGG + Intergenic
1188389343 X:29600667-29600689 GTAGAGAAAGACCACCAGGTGGG + Intronic
1189879061 X:45470628-45470650 CTAGGGAAGGACCATCAGGTGGG - Intergenic
1191026536 X:55919764-55919786 GTAGAGAAAGACCACCAGGTGGG - Intergenic
1191223336 X:58014929-58014951 CTAGAGAAAGATCACCAGGTGGG - Intergenic
1191820471 X:65300551-65300573 GTAGAGAAAGACCACCAGGTGGG - Intergenic
1192852991 X:74977513-74977535 GTAGAGAAAGACCACCAGGTGGG + Intergenic
1192979036 X:76319051-76319073 ATAGAAAAGGACCATCAGGTGGG + Intergenic
1193077024 X:77365058-77365080 ATAGAGAAGGACCATCAGGTGGG - Intergenic
1196224133 X:113145789-113145811 ATGGAGAAAGATCACCAGGTAGG + Intergenic
1196231875 X:113233577-113233599 GTAGAGAAAGACCACCAGGTAGG + Intergenic
1196949015 X:120857375-120857397 GTAGAGAATGACCACCAGGTGGG - Intergenic
1197184418 X:123570527-123570549 GTAGAGAAAGACCACCAGGTGGG - Intergenic
1197953713 X:131923939-131923961 ATAGGAAAGGACCACCAGGTGGG - Intergenic
1198664751 X:139008191-139008213 GTGGAGAAAAACCACCAGGTGGG - Intronic
1199521497 X:148741241-148741263 ATAGAGAAGGACCATCAGGTGGG + Intronic