ID: 1117375347

View in Genome Browser
Species Human (GRCh38)
Location 14:55113904-55113926
Sequence GCACTTTGGGAGGCCAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117375347_1117375357 9 Left 1117375347 14:55113904-55113926 CCCACCTTGGCCTCCCAAAGTGC No data
Right 1117375357 14:55113936-55113958 TAGGCATGGACCACCATGCCTGG No data
1117375347_1117375354 -10 Left 1117375347 14:55113904-55113926 CCCACCTTGGCCTCCCAAAGTGC No data
Right 1117375354 14:55113917-55113939 CCCAAAGTGCTGGGACTTATAGG No data
1117375347_1117375359 19 Left 1117375347 14:55113904-55113926 CCCACCTTGGCCTCCCAAAGTGC No data
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data
1117375347_1117375356 -5 Left 1117375347 14:55113904-55113926 CCCACCTTGGCCTCCCAAAGTGC No data
Right 1117375356 14:55113922-55113944 AGTGCTGGGACTTATAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117375347 Original CRISPR GCACTTTGGGAGGCCAAGGT GGG (reversed) Intergenic