ID: 1117375348

View in Genome Browser
Species Human (GRCh38)
Location 14:55113905-55113927
Sequence AGCACTTTGGGAGGCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 511305
Summary {0: 55360, 1: 145174, 2: 158991, 3: 100124, 4: 51656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117375348_1117375357 8 Left 1117375348 14:55113905-55113927 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1117375357 14:55113936-55113958 TAGGCATGGACCACCATGCCTGG 0: 11
1: 683
2: 9325
3: 39090
4: 92033
1117375348_1117375356 -6 Left 1117375348 14:55113905-55113927 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1117375356 14:55113922-55113944 AGTGCTGGGACTTATAGGCATGG No data
1117375348_1117375359 18 Left 1117375348 14:55113905-55113927 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117375348 Original CRISPR AGCACTTTGGGAGGCCAAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr