ID: 1117375350

View in Genome Browser
Species Human (GRCh38)
Location 14:55113908-55113930
Sequence CCCAGCACTTTGGGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 763604
Summary {0: 79234, 1: 201556, 2: 232767, 3: 156913, 4: 93134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117375350_1117375359 15 Left 1117375350 14:55113908-55113930 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data
1117375350_1117375356 -9 Left 1117375350 14:55113908-55113930 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1117375356 14:55113922-55113944 AGTGCTGGGACTTATAGGCATGG No data
1117375350_1117375357 5 Left 1117375350 14:55113908-55113930 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1117375357 14:55113936-55113958 TAGGCATGGACCACCATGCCTGG 0: 11
1: 683
2: 9325
3: 39090
4: 92033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117375350 Original CRISPR CCCAGCACTTTGGGAGGCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr